Molecular characterization of the first aromatic nutrient transporter from the sodium neurotransmitter symporter family

Abstract

SUMMARY Nutrient amino acid transporters (NATs, subfamily of sodium neurotransmitter symporter family SNF, a.k.a. SLC6) represent a set of phylogenetically and functionally related transport proteins, which perform intracellular absorption of neutral, predominantly essential amino acids. Functions of NATs appear to be critical for the development and survival in organisms. However, mechanisms of specific and synergetic action of various NAT members in the amino acid transport network are virtually unexplored. A new transporter, agNAT8, was cloned from the malaria vector mosquito Anopheles gambiae (SS). Upon heterologous expression in Xenopus oocytes it performs high-capacity, sodium-coupled (2:1)uptake of nutrients with a strong preference for aromatic catechol-branched substrates, especially phenylalanine and its derivatives tyrosine and L-DOPA,but not catecholamines. It represents a previously unknown SNF phenotype, and also appears to be the first sodium-dependent B0 type transporter with a narrow selectivity for essential precursors of catecholamine synthesis pathways. It is strongly and specifically transcribed in absorptive and secretory parts of the larval alimentary canal and specific populations of central and peripheral neurons of visual-, chemo- and mechano-sensory afferents. We have identified a new SNF transporter with previously unknown phenotype and showed its important role in the accumulation and redistribution of aromatic substrates. Our results strongly suggest that agNAT8 is an important, if not the major, provider of an essential catechol group in the synthesis of catecholamines for neurochemical signaling as well as ecdysozoan melanization and sclerotization pathways, which may include cuticle hardening/coloring, wound curing, oogenesis, immune responses and melanization of pathogens.

Molecular cloning, phylogeny and localization of AgNHA1: the first Na+/H+ antiporter (NHA) from a metazoan,Anopheles gambiae

“…A full-length sequence was obtained and designated Anopheles gambiae Na + /H + antiporter 1 (AgNHA1; GenBank accession number EF014219) using terminal primers: 5Ј-ATTATCAAGA -TGCCTTCGGAGGAA-3Ј and 5Ј-CTACTTCGTGATG GTG -AACGCTGTCGCCGTTT-3Ј. The resulting PCR product was inserted into a pCR4-TOPO vector (Invitrogen, Carlsbad, CA, USA) and sequenced to verify that no PCR errors had been introduced, using methods that were described earlier (Meleshkevitch et al, 2006).…”

“…The initial multiple alignment used ClustalX (ver1.81) (Thompson et al, 1997) with default parameters; all gaps were removed manually using GeneDoc (Nicholas et al, 1997) prior to tree construction. The graphical output was generated using TreeView software (Page, 1996) (for details, see Meleshkevitch et al, 2006).…”

“…Tissues were pre-fixed, isolated from fourth instar An. gambiae larvae, pre-hybridized, hybridized, fixed and labeled with alkaline phosphataseconjugated, anti-DIG antibodies by a slightly modified version of the methods published (Meleshkevitch et al, 2006). Hybridization patterns were visualized in a NBT/BCIP alkaline buffer solution (Roche Diagnostics).…”

“…RNA isolation, cDNA synthesis, qPCR experiments and data analysis were performed as described (Meleshkevitch et al, 2006). AgNHA1-specific primers designed using Primer Express v.2.0 software (Applied Biosystems; Foster City, CA, USA) had the following sequences: AgNHA1-1105F= CTGGATCCTCACATCGTATCGA; AgNHA1-1176R=CGT -TGTCAAGATGCGGATCA.…”

“…gambiae larvae as described (Meleshkevitch et al, 2006). Tissues were fixed in 4% paraformaldehyde/PBS (PFA), rinsed in PBS, incubated in an ethanol dehydration/rehydration series, rinsed with PBS containing 0.3% Triton X-100 (PBT) and blocked overnight at 4°C with a solution of 2% normal goat serum (NGS), 1% bovine serum albumin (BSA) in PBT.…”