Molecular evidence for the existence of five cryptic species within the Japanese species of <i>Marphysa</i> (Annelida: Eunicidae) known as “Iwa-mushi”

Abstract

Molecular phylogenetic analyses were conducted to clarify how genetically homogeneous the common Japanese species of Marphysa known as Iwa-mushi is. This is a well-known polychaete used as a fishing bait that was first described as Marphysa iwamushi Izuka, 1907 (type locality: Japan and Taiwan) and later synonymized to Marphysa sanguinea (Montagu, 1813) (type locality: England). The nucleotide sequences of a nuclear gene (18S rRNA) and two mitochondrial genes (16S rRNA and cytochrome c oxidase subunit I (COI)) were compared between specimens newly collected from 14 localities in Japan including commercially sold fishing baits and DDBJ/ENA/GenBank data for congeneric species. Our results show that the Japanese Iwa-mushi is not a single species but a species complex comprising five genetically well-separated clades that were tentatively designated as five undetermined species (Marphysa spp. A, B, C, D, and E). It is unclear whether any of these species corresponds to M. iwamushi. The COI nucleotide sequence of Marphysa sp. A was almost identical to that of M. victori Lavesque, Daffe, Bonifácio & Hutchings, 2017 (type locality: France) and M. bulla Liu, Hutchings & Kupriyanova, 2018 (type locality: China), suggesting that they are conspecific and supporting the hypothesis of Lavesque et al. (2017) that the population in France was introduced from Japan. The COI sequence of Marphysa sp. B corresponds to that of M. maxidenticulata Liu, Hutchings & Kupriyanova, 2018 (type locality: China). Marphysa sp. E was found only in Tokyo Bay and may be an alien species that was introduced by importing live fishing bait. Our results indicate that the European species M. sanguinea is not distributed in Japanese waters.

Morphological and molecular systematic review ofMarphysaQuatrefages, 1865 (Annelida: Eunicidae) species from South Africa

“…Molecular data provide an additional source of information that improves our knowledge on species boundaries and aids in recognition of intraspecific variation (e.g., Lewis & Karageorgopoulos, 2008 ; Zanol, Da Silva & Hutchings, 2016 ; Zanol, Da Silva & Hutchings, 2017 ; Lavesque et al, 2017 ; Elgetany et al, 2018 ; Lavesque et al, 2019 ; Glasby et al, 2019 ; Abe et al, 2019 ; Martin et al, 2020 ). The phylogenetic tree revealed two distinct South African monophyletic clades, belonging to the new species M. sherlockae n. sp.…”

“…A total of nine Marphysa species have been newly proposed or redescribed under an integrative taxonomic framework since 2003 ( Zanol, Da Silva & Hutchings, 2016 ; Zanol, Da Silva & Hutchings, 2017 ; Lavesque et al, 2017 ; Elgetany et al, 2018 ; Lavesque et al, 2019 ; Glasby et al, 2019 ; Abe et al, 2019 ; Martin et al, 2020 ; present study), thus, increasing the number of publicly available sequences of Marphysa species globally. This framework, in turn, provides a starting point from which other studies can address more complex hypotheses, such as resolving the phylogenetic placements of species within the genus.…”

Molecular identification and larval morphology of spionid polychaetes (Annelida, Spionidae) from northeastern Japan

“…Partial sequences of nuclear 18S rRNA gene were amplified by PCR according to the methods described by Sato‐Okoshi and Abe (2012 , 2013 ) and Teramoto et al (2013) using the following primer pairs (Nishitani et al 2012): 18S‐1F1 (AACCTGGTTKATCCTGCCAG) and 18S‐1R632 (ACTACGAGCTTTTTAACYGCARC), 18S‐2F576 (GGTAATTCCAGCTCYAATRG) and 18S‐2R1209 (AAGTTTYCCCGTGTTGARTC), and 18S‐3F1129 (GCTGAAACTTAAAGRAATTGACGG) and 18S‐R1772 (TCACCTACGGAAACCTTGTTACG). Partial sequences of mitochondrial 16S rRNA gene were amplified by PCR according to the methods described by Abe et al (2019a) using the 16Sar (CGCCTGTTTATCAAAAACAT) and 16Sbr (CCGGTCTGAACTCAGATCACGT) primer pair ( Palumbi et al 1991 ). The PCR products were purified using ExoSAP‐IT (Affymetrix, Cleveland, OH, USA) and sequenced by Eurofins Genomics (Tokyo, Japan).…”

The Current State of Eunicida (Annelida) Systematics and Biodiversity

“…Some local fauna studies focusing on eunicid taxa are available for the Antarctic and Subantarctic Seas [13], Argentina [170], Australia [24,131,[171][172][173][174][175], Brazil [133,[176][177][178][179][180], British Isles [181], the Canary Islands [182], the Caribbean Sea [25,42,122,124,130,136,139,[183][184][185][186], China [187,188], the eastern Pacific [28], the El Salvador Pacific Coast [189], Fiji and Samoa [190], the French Atlantic Coast [191], the Gulf of Mexico [192,193], Hong Kong [194], the Iberian Peninsula [132,195], India [196,197], Japan [135,[198][199][200][201][...…”

“…L. collaris has panmitic populations, while L. ninetta includes two genetic lineages corresponding to different color morphs separated at around 3.7-3.4 million years ago, which may be different species [225,228]. Molecular analyses using nucleotide sequences of cytochrome oxidase I (COI) and 16S rDNA have become common in papers on eunicid species [202,230]. These have aided in understanding intraspecific variation, such as the lack of a subacicular hook in large specimens of some Marphysa species [47], in improving species recognition and in revealing a hidden biodiversity even in well-studied places.…”