Molecular Spectrum of β-Thalassemia Mutations in the admixed Venezuelan population, and their linkage to β-Globin Gene Haplotypes

Abstract

In order to establish the spectrum of β-thalassemia (β-thal) mutations in the Venezuelan population for the first time, 127 unrelated subjects either with a suspicion of β-thal trait or with a clinically recognized β-thal syndrome of different degrees of severity, were studied. DNA from these subjects was analyzed by a polymerase chain reaction (PCR)-based reverse dot-blot method or amplification refractory mutation system (ARMS). Prototype β-globin gene sequencing of relevant DNA was performed to confirm the mutations. Fifteen different mutations were identified accounting for 92.0% of the mutant alleles explored, revealing a significant genetic heterogeneity at the β-globin gene locus in this population. The most frequent mutations were codon 39 (C >T) 34.1%, IVS-I-1 (G >A) 11.1%, IVS-I-6 (T > C) 6.6%, IVS-I-110 (G >A) 6.6%, IVS-II-849 (A >G) 6.6%, -88 (C >T) 6.0%, -29 (A >G) 5.2%, followed by the less common IVS-I-5 (G >A) 3.7%, the 1,393 bp deletion 3.0%, IVS-II-1 (G >A) 3.0%, -86 (C >G) 2.2%, IVS-II-1 (G >T) 1.5%, codons 41/42 (-TCTT) 1.5%, IVS-II-745 (C >G) 0.7% and deletional δβ-thal 0.7%. Overall, these data demonstrate that the major sources of β-thal alleles in Venezuela, as expected, are of Mediterranean and African origins. This is the first large study defining the molecular spectrum of β-thal in the highly admixed population of Venezuela and lays the foundation for genetic counseling as well as implementing comprehensive clinical care programs. Diversity of haplotypes associated with some of the β-thal mutations can be explained by in situ recombination events in Venezuela.

Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

“…Most of the β‐thal mutations observed in our patients are of Mediterranean origin (10/21), including the four most common mutations (Cd 39 C>T, IVS1:1 G>A, IVS1:110 G>A, and δβ‐thal Spanish) (Table ), and this is consistent with the origins of Mexican mestizo population, which is mainly of Spaniard origin . The most frequent mutation, Cd 39 C>T (37.2%), is also the most common in Venezuela (34.1%), Brazil (36.8%), Cuba (30.5%), and Argentina (42.6%); this mutation has been observed all over the world …”

“…The IVS1:1 G>A and IVS1:110 G>A mutations have similar frequencies in our population (17.3% and 13.9%, respectively) (Table ); these mutations have also been observed in Venezuela (11.1% and 6.6%, respectively), Brazil (9.5% and 15.5%), Cuba (6.1% and 8.5%), and Argentina (11.1% and 21.7%) …”

“…A similar mutation (‐90 C>T) was associated with an eightfold decreased transcription rate of the HBB gene . In the proximal CACCC sequence, there are at least nine different previously described mutations, of which only four have been observed in Latin American populations: ‐90 C>T has been observed in Jamaica with a frequency of 1.0%; ‐88 C>T in Venezuela (6.0%), Brazil (1.6%), and Cuba (2.4%); ‐87 C>T in Mexicans and Argentineans in 0.8% each; and ‐86 C>G in Venezuela (2.2%) …”

“…On the other hand, δβ‐thal Spanish is less common in Latin American countries as only few reports have been published in Venezuela (0.7%) and Brazil (present in 3/60 individuals with increased HbF); however, in Spain, this variant is rather frequent as 7% of thalassemia carriers have δβ‐thal Spanish type; therefore, we assume that this allele was introduced to Mexican population through the Spaniards during the colonization.…”

The Current Status of β-Thalassemia Major in Mainland China

“…These phenotypes are associated with more than 200 different mutations that either reduce (β þ -thal) or abolish (β 0thal) expression of the affected β-globin genes. β-Thalassemia major occurs in homozygous or compound heterozygous states for such mutations (7). Patients with β-TM require long-term blood transfusion and chelation therapy.…”