Molecular systematics, biogeography, and colony fusion in the European dry-wood termites Kalotermes spp. (Blattodea, Termitoidae, Kalotermitidae)

Abstract

European dry-wood termites belong to the genus Kalotermes (Kalotermitidae), one of the two termite genera in Europe. Until the recent description of two new species, Kalotermes italicus in Italy and Kalotermes phoenicae in the eastern Mediterranean area, Kalotermes flavicollis was the only taxon known in this region. The presence of additional entities, suggested by morphological and physiological variation observed in K. flavicollis, was supported by molecular studies revealing four distinct genetic lineages: lineage A, K. flavicollis sensu strictu, from the Aegean area to Italy; lineage B, in Tuscany; lineage SC, in Sardinia and Corsica; lineage SF, in southern France. Lineages A and B may form mixed colonies, suggesting hybridization. To draw a more detailed picture of Kalotermes evolution and biogeography in Europe, we analyzed samples from previously unsampled areas, such as Spain and southern Italy, by means of the highly informative cox1/trnL/cox2 mitochondrial DNA marker. Overall, phylogenetic analyses confirmed previously identified lineages and taxa, but widened the distribution of the lineage SC to the mainland and of the lineage SF to Spain and Portugal. Results further provided evidence for the synonymy between lineage B and K. italicus. Species delimitation analysis suggested that the three K. flavicollis lineages, as well as K. italicus, can be separate taxa. Data also suggest a possible interspecific hybridization between K. italicus and both K. flavicollis lineages A and SC.

Molecular analyses of the Kalotermes dispar-complex (Blattodea: Kalotermitidae) from the Canary Islands reveal cryptic intraspecific divergence and a connection to a lone Nearctic congener

“…However, the taxonomy of Kalotermes is still far from being complete due to the existence of cryptic diversity within the genus, as well as undiscovered species in unsampled areas. Apart from the recently described K. italicus and K. phoenicae , Scicchitano et al (2018) showed a strong geographic structure within K. flavicollis of Western Europe, suggesting the existence of potential new species. In this study, we present new data on Kalotermes’s molecular systematics and phylogenetics, focusing on the intraspecific genetic variation of the Canarian K. dispar colonies.…”

“…The total DNA was isolated from the head using the NucleoSpin DNA Insect Mini Kit (Macherey-Nagel). Mitochondrial fragments PCR amplification was carried out with Promega GoTaq2, with thermal cycling as described in Scicchitano et al (2018) and Suárez et al (2022) , using the following primers: cox2 , C1-J-2797 (5ʹ-CCTCGACGTTATTCAGATTACC-3ʹ) and TK-N-3785 (5ʹ-GTTTAAGAGACCAGTACTTG-3ʹ) ( Simon et al 1994 ) or TL2-J-30307 (5ʹ-TAATATGGCAGATTAGTGCATTGGA-3ʹ) ( Simon et al 1994 ) and TK-N-3785 (5ʹ-GAGACCATTACTTGCTTTCAGTATCT-3ʹ) ( Gómez-Zurita et al 2000 ); rrnL , R-J-12887 (5ʹ-CCGGTCTGAACTCAGATCACGT-3ʹ) and LR-N-13398 (CGCCTGTTTAACAAAAACAT) ( Simon et al 1994 ; Palumbi 1996 ). After the amplified fragments’ purification with an ExoSap kit (Invitrogen), Sanger sequencing was performed at Macrogen Europe.…”

“…Like many other kalotermitid genera, Kalotermes build small colonies and nest in live or dead branches and trunks, which provide both shelter and food (so-called “one-piece nesters,” Abe 1987 ). This lifestyle has two primary outcomes: (i) continuous increase of the nest size with consequent frequent colony fusions because of the likely encounter when nesting within the same wood log ( Luchetti et al 2013 , Scicchitano et al 2018 ), (ii) ease of passive dispersal by moving the infested wood itself. In fact, wood rafting overwater has been suggested as one of the main drivers of the worldwide distribution and island colonization of kalotermitids ( Scheffrahn et al 2006 , Thiel and Haye 2006 , Scheffrahn and Postle 2013 , Buček et al 2022 ).…”

“…In the Palearctic region, five species are currently described. Across Europe, three species are found, including the type species Kalotermes flavicollis Fabricius, 1793, which was also found to include three distinct lineages ( Velonà et al 2011 , Scicchitano et al 2018 ), and two of them have been described very recently: Kalotermes italicus Ghesini and Marini, 2013 and Kalotermes phoenicae Ghesini and Marini, 2015 ( Ghesini and Marini 2013 , 2015 ). In addition, Kalotermes monticola monticola Sjöstedt, 1925 and Kalotermes monticola brachycephala Sjöstedt, 1926 are found in Algeria, and Kalotermes dispar Grassé, 1938 inhabits the Canary Islands ( Krishna et al 2013 ).…”

The Impact of Constrictotermes cyphergaster (Termitidae: Nasutitermitinae) Termites on Semiarid Ecosystems in Brazil: A Review of Current Research

“…There is growing interest in the genetic structures of termite populations [ 30 ], biogeography, and phylogeny, with recent studies of Heterotermes and Kalotermes [ 31 , 32 ]. Inbreeding is an integral part of the colony life cycle in many species, and has been the focal point in discussions of the evolution of eusociality in the group [ 33 ].…”