Multianalytical Study of the Binding between a Small Chiral Molecule and a DNA Aptamer: Evidence for Asymmetric Steric Effect upon 3′- versus 5′-End Sequence Modification

Abstract

Nucleic acid aptamers are involved in a broad field of applications ranging from therapeutics to analytics. Deciphering the binding mechanisms between aptamers and small ligands is therefore crucial to improve and optimize existing applications and to develop new ones. Particularly interesting is the enantiospecific binding mechanism involving small molecules with nonprestructured aptamers. One archetypal example is the chiral binding between l-tyrosinamide and its 49-mer aptamer for which neither structural nor mechanistic information is available. In the present work, we have taken advantage of a multiple analytical characterization strategy (i.e., using electroanalytical techniques such as kinetic rotating droplet electrochemistry, fluorescence polarization, isothermal titration calorimetry, and quartz crystal microbalance) for interpreting the nature of binding process. Screening of the binding thermodynamics and kinetics with a wide range of aptamer sequences revealed the lack of symmetry between the two ends of the 23-mer minimal binding sequence, showing an unprecedented influence of the 5' aptamer modification on the bimolecular binding rate constant k and no significant effect on the dissociation rate constant k. The results we have obtained lead us to conclude that the enantiospecific binding reaction occurs through an induced-fit mechanism, wherein the ligand promotes a primary nucleation binding step near the 5'-end of the aptamer followed by a directional folding of the aptamer around its target from 5'-end to 3'-end. Functionalization of the 5'-end position by a chemical label, a polydA tail, a protein, or a surface influences the kinetic/thermodynamic constants up to 2 orders of magnitude in the extreme case of a surface immobilized aptamer, while significantly weaker effect is observed for a 3'-end modification. The reason is that steric hindrance must be overcome to nucleate the binding complex in the presence of a modification near the nucleation site.

Metal Ion‐Terpyridine‐Functionalized L‐Tyrosinamide Aptamers: Nucleoapzymes for Oxygen Insertion into CH Bonds and the Transformation of L‐Tyrosinamide into Amidodopachrome

“…In addition, in contrast to the set of 6‐carboxyfluorescein‐modified aptamers associated with the nucleoapzymes I–IV, that revealed identical K d values for all nucleoapzymes, we observe a clear effect of the flexible 4 × T chain on the binding properties of L‐tyrosinamide, (1), to the 23‐mer aptamer binding sequence. While the direct linkage of the 6‐carboxyfluorescein to the 5′‐ or 3′‐end of the aptamer, associated with the nucleoapzymes VI and VII, respectively, reveals similar binding affinities, K d = (2.5 ± 0.1) × 10 −6 m , the 6‐carboxyfluorescein‐modified aptamers associated with the nucleoapzymes VIII and IX, that include the 4 × T bridges separating the 6‐carboxyfluorescein from the 5′‐ or 3′‐end of the aptamer, reveal significantly higher, yet similar, binding affinities toward (1), K d = (0.9 ± 0.02) × 10 −6 m (similar to the reported K d value of L‐tyrosinamide to the bare short aptamer). As it was stated earlier, the bases at the end of the 23‐mer aptamer were reported to play an important role in the association of L‐tyrosinamide to the aptamer .…”

“…Figure A depicts the schematic configuration of a metal ion‐terpyridine‐functionalized nucleoapzyme for the catalyzed oxidation of L‐tyrosinamide. The Cu 2+ ‐ or Fe 3+ ‐terpyridine complexes were covalently tethered to the amino‐functionalized L‐tyrosinamide aptamer (49‐mer), or the shortened L‐tyrosinamide aptamer (23‐mer) to yield the respective metal ion‐terpyridine‐functionalized nucleoapzymes. The resulting nucleoapzymes were then examined as catalysts for the sequestered transformation of L‐tyrosinamide (1) to amidated L‐DOPA (2) and, subsequently, to amidodopachrome (3), Figure B.…”

“…(We note that the K d value of L‐tyrosinamide to the 6‐carboxyfluorescein‐functionalized aptamers are similar to the K d values reported for the bare aptamers using other methods. ) Microscale thermophoresis (MST) is a useful technique to evaluate the dissociation constants of ligand‐receptor complexes, and the MST method was successfully applied to derive the K d values of ATP or thrombin to their aptamers . Table 2 displays the MST‐derived K d values of the L‐tyrosinamide substrate to the 6‐carboxyfluorescein‐modified aptamers associated with the nucleoapzymes I–IV.…”

“…Recently, it was reported that a shorter 23‐mer nucleic acid sequence (5′‐TGTGGTGTGTGAGTGCGGTGCCC‐3′), that consists of the 3′‐end of the 49‐mer sequence (5′‐AATTCGCTAGCTGGAGCTTGGATTGATGTGGTGTGTGAGTGCGGTGCCC‐3′), reveals even higher binding affinities toward L‐tyrosinamide (1) . Furthermore, it was suggested that the two bases at the 5′‐ and 3′‐ends play a central role in the binding of the substrate (1) to the aptamer.…”

“…We found that, in the presence of a mixture of L‐ascorbic acid/H 2 O 2 , the hydroxylation of L‐tyrosine to L‐DOPA proceeds, and the resulting L‐DOPA is, subsequently, oxidized to dopachrome. Realizing that a sequence‐specific aptamer that binds L‐tyrosinamide was reported (it also binds with a lower affinity L‐tyrosine itself), we attempted to design a nucleoapzyme that could catalyze the hydroxylation of L‐tyrosinamide to amidated L‐DOPA and, subsequently, to induce the catalyzed transformation of the catechol product to amidodopachrome.…”