Multiple Endoplasmic Reticulum-to-Nucleus Signaling Pathways Coordinate Phospholipid Metabolism with Gene Expression by Distinct Mechanisms

Abstract

In many organisms the coordinated synthesis of membrane lipids is controlled by feedback systems that regulate the transcription of target genes. However, a complete description of the transcriptional changes that accompany the remodeling of membrane phospholipids has not been reported. To identify metabolic signaling networks that coordinate phospholipid metabolism with gene expression, we profiled the sequential and temporal changes in genome-wide expression that accompany alterations in phospholipid metabolism induced by inositol supplementation in yeast. This analysis identified six distinct expression responses, which included phospholipid biosynthetic genes regulated by Opi1p, endoplasmic reticulum (ER) luminal protein folding chaperone and oxidoreductase genes regulated by the unfolded protein response pathway, lipid-remodeling genes regulated by Mga2p, as well as genes involved in ribosome biogenesis, cytosolic stress response, and purine and amino acid metabolism. We also report that the unfolded protein response pathway is rapidly inactivated by inositol supplementation and demonstrate that the response of the unfolded protein response pathway to inositol is separable from the response mediated by Opi1p. These data indicate that altering phospholipid metabolism produces signals that are relayed through numerous distinct ER-to-nucleus signaling pathways and, thereby, produce an integrated transcriptional response. We propose that these signals are generated in the ER by increased flux through the pathway of phosphatidylinositol synthesis. The endoplasmic reticulum (ER)2 is a dynamic organelle that responds to environmental and developmental cues by regulating the levels of lipids and proteins required for the biogenesis and maintenance of membrane-bound compartments. It is the site of the synthesis and turnover of a major fraction of the lipid components that comprise the entire endomembrane system (1, 2), including phosphatidylinositol (PI), which is the precursor of the essential glycosylphosphatidylinositol lipids, sphingolipids, and phosphoinositides, as well as the soluble inositol polyphosphates (reviewed in Refs. 3-5). A variety of feedbackcontrol systems have been described in animals and fungi that allow cells to monitor and adjust membrane constituents to their proper stoichiometry. For example, the sterol regulatoryelement-binding protein-Scap pathway, which senses sterol levels in the ER, regulates the transcription of genes required for sterol biosynthesis (reviewed in Ref. 6), whereas the unfolded protein response (UPR) pathway, which senses ER secretory stress, regulates the expression of genes that are required for ER homeostasis (reviewed in Ref. 7). However, our understanding of how cells sense the ER membrane environment, then integrate and transmit these signals to the nucleus is incomplete.The model eukaryote, Saccharomyces cerevisiae, adjusts its membrane lipid composition according to the availability of the soluble phospholipid precursors, inositol and choline (8 -13). The additi...

NTE1-encoded Phosphatidylcholine Phospholipase B Regulates Transcription of Phospholipid Biosynthetic Genes

“…The UPR and CWI pathways are both activated under this growth condition indicating that this phospholipid composition somehow hampers normal ER function and confers cell stress (22,32,36,40). Consistent with the notion of a synthetic impairment between challenged ER function and inositol deprivation, we observed a substantial improvement in the cellular performance of wild type cells exposed to the UPR inducer tunicamycin in medium augmented with inositol.…”

“…CGTTATTGGAGGAACAGCGATTGGTTCC R-NTE1-S1406A GGAACCAATCGCTGTTCCTCCAATAACG described previously (36). Membranes were probed in formamide hybridization buffer with strand-specific 32 P-labeled riboprobes, obtained from linearized plasmids pJH310-INO1 and pSJ34-ACT1 by in vitro transcription.…”

Bcp1 Is the Nuclear Chaperone of Rpl23 in Saccharomyces cerevisiae

“…Therefore, the InsP6 metabolism pathway was proposed to affect 60S biogenesis (53). There is additional evidence of coupling between the inositol pathway and ribosome biogenesis; the addition of inositol to yeast cultures leads to an extremely fast transcriptional response, including genes involved in large ribosomal subunit assembly, rRNA transcription, processing, and modification (54). Additionally, mTORC2, a serine/threonine kinase conserved from yeast to humans, regulates the dynamics and organization of the cytoskeleton.…”

Activation of Protein Kinase C-Mitogen-activated Protein Kinase Signaling in Response to Inositol Starvation Triggers Sir2p-dependent Telomeric Silencing in Yeast

“…Microarray studies have revealed that the transcript levels of hundreds of genes in yeast are affected by the availability of the phospholipid precursor, inositol (1)(2)(3)(4). The INO1 gene, encoding inositol-3-phosphate synthase, and other genes involved in lipid metabolism are repressed by the Opi1p repressor in response to the presence of exogenous inositol (5)(6)(7)(8)(9)(10).…”

“…The INO1 gene, encoding inositol-3-phosphate synthase, and other genes involved in lipid metabolism are repressed by the Opi1p repressor in response to the presence of exogenous inositol (5)(6)(7)(8)(9)(10). However, the majority of the genes that are regulated in response to inositol availability in wild type cells are not involved in phospholipid metabolism and are not under the control of the Opi1p repressor (1,2). Many of genes that are induced in the absence of inositol are targets of stress response pathways that have been shown to be activated in the absence of exogenous inositol, including the unfolded protein response and the protein kinase C (PKC) pathway (1)(2)(3)(11)(12)(13).…”