Multiple Resistance to Glyphosate and Acetolactate Synthase Inhibitors in Palmer Amaranth (<i>Amaranthus palmeri</i>) Identified in Brazil

Küpper, Anita; Borgato, Ednaldo Alexandre; Patterson, Eric; Netto, Acácio Gonçalves; Nicolai, Marcelo; Carvalho, Saul Jorge Pinto de; Nissen, Scott J.; Gaines, Todd A.; Christoffoleti, Pedro Jacob

doi:10.1017/wsc.2017.1

Cited by 60 publications

(87 citation statements)

References 46 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The resistant Palmer amaranth accessions from Mississippi were cross‐resistant to IMIs, PTBs and SUs. The ALS‐resistant Palmer amaranth discovered recently in Brazil all carried the Trp574Leu mutation, whereas 42% of these plants also had the Ser653Asn mutation . The Palmer amaranth from Brazil was resistant to SUs, but was not tested for cross‐resistance to other ALS herbicide families.…”

Section: Resultsmentioning

confidence: 99%

“…The ALS-resistant Palmer amaranth discovered recently in Brazil all carried the Trp574Leu mutation, whereas 42% of these plants also had the Ser653Asn mutation. 46 The Palmer amaranth from Brazil was resistant to SUs, but was not tested for cross-resistance to other ALS herbicide families. In tall waterhemp, Trp574Leu endowed high levels of resistance to the ALS inhibitors tested including IMIs, SUs and TPs, whereas Ser653Asn caused resistance only to the IMIs.…”

Section: Als Sequence Analysismentioning

confidence: 99%

See 1 more Smart Citation

Target‐site mutation accumulation among ALS inhibitor‐resistant Palmer amaranth

Singh

Salas-Perez

et al. 2018

Pest Management Science

View full text Add to dashboard Cite

BACKGROUND Palmer amaranth (Amaranthus palmeri S. Wats) is one of the most common and troublesome weeds in the USA. Palmer amaranth resistance to acetolactate synthase (ALS) inhibitors is widespread in the USA, as in Arkansas. The cross‐resistance patterns and mechanism of resistance are not known. Experiments were conducted to determine cross‐resistance to ALS inhibitors and identify target‐site mutations in 20 Palmer amaranth localities from 13 counties in Arkansas. RESULTS All Palmer amaranth localities tested had plants cross‐resistant to imazethapyr, flumetsulam, primisulfuron, pyrithiobac and trifloxysulfuron. The dose of trifloxysulfuron that caused 50% control was 21–56‐fold greater for resistant accessions than for susceptible ones. All but three resistant plants analyzed had one or two relative copies of ALS; one plant had seven relative copies. All resistant plants tested (18 localities) carried the Trp574Leu mutation, which is known to confer broad resistance to ALS inhibitors, supporting the cross‐resistance pattern observed. Besides the Trp574Leu mutation, 30% of localities had individuals with one additional resistance‐conferring mutation including Ala122Thr, Pro197Ala or Ser653Asn. CONCLUSION The Trp574Leu mutation in ALS is the primary mechanism of resistance to ALS inhibitors in Palmer amaranth from Arkansas, USA. In some localities, multiple mutations have accumulated in one plant. All localities tested contained plants with resistance to five families of ALS inhibitors. Localities with extremely high resistance to ALS inhibitors, and those outside the subset we studied, may harbor non‐target site resistance mechanisms. ALS inhibitors are generally no longer effective on Palmer amaranth in these localities from the US mid‐south. © 2018 Society of Chemical Industry

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Als Sequence Analysismentioning

confidence: 99%

Target‐site mutation accumulation among ALS inhibitor‐resistant Palmer amaranth

Singh

Salas-Perez

et al. 2018

Pest Management Science

View full text Add to dashboard Cite

show abstract

“…Two KASP assays were used to determine whether individuals had S A. palmeri , R A. tuberculatus or hybrid (heterozygous) genotypes. The first SNP was located at base pair 678 in the ALS coding sequence and has been used previously as a RFLP marker (Tranel et al ., ) and as a KASP marker (Küpper et al ., ). The second marker is a 2‐bp polymorphism in the ITS of the ribosomal coding region (TBP‐ITS), designed to distinguish A. palmeri from eight other Amaranthus species (Table S4).…”

Section: Methodsmentioning

confidence: 97%

“…The protocol detailed in Küpper et al . () was used for the ALS marker. In brief, the ALS‐SNP assay used the following primers: A. tuberculatus forward primer, 5′‐GAAGGTGACCAAGTTCATGCTAAAAAGAAAGCTTCCTTAACAATTCTAGGG‐3′ (FAM Tag underlined); A. palmeri forward primer, 5′‐GAAGGTCGGAGTCAACGGATTAAAAAGAAAGCTTCCTTAACAATTCTAGGA‐3′ (HEX Tag underlined); universal reverse primer, 5′‐GTTGAGGTAACTCGATCCATTACTA AGC‐3′.…”

Section: Methodsmentioning

confidence: 99%

Interspecific and intraspecific transference of metabolism‐based mesotrione resistance in dioecious weedy Amaranthus

et al. 2018

Self Cite

View full text Add to dashboard Cite

Pollen-mediated gene flow (PMGF) might play an important role in dispersing herbicide resistance alleles in dioecious weedy Amaranthus species. Field experiments in a concentric donor-receptor design were conducted to quantify two sets of PMGF studies, an interspecific (Amaranthus tuberculatus × Amaranthus palmeri) and an intraspecific (A. tuberculatus × A. tuberculatus). In both studies, PMGF was evaluated using a resistant A. tuberculatus phenotype with enhanced mesotrione detoxification via P450 enzymes as a source of resistance alleles. For interspecific hybridization, more than 104 000 putative hybrid seedlings were screened with three markers, one phenotypic and two molecular. The two molecular markers used, including 2-bp polymorphisms in the internal transcribed spacer region, distinguished A. palmeri, A. tuberculatus and their hybrids. Results showed that 0.1% hybridization between A. tuberculatus × A. palmeri occurred under field research conditions. For intraspecific hybridization, 22 582 seedlings were screened to assess the frequency of gene flow. The frequency of gene flow (F ) varied with distance, direction and year of the study. The farthest distance for 90% reduction of F was at 69 m in 2015 however, after averaging across directions it was 13.1 and 26.1 m in 2014 and 2015, respectively. This study highlights the transfer of metabolism-based mesotrione resistance from A. tuberculatus to A. palmeri under field research conditions. The results presented here might aid in the rapid detection of A. palmeri among other Amaranthus species and show that PMFG could be expediting the increase of herbicide resistance in A. palmeri and A. tuberculatus across US crop production areas.

show abstract

“…Molecular diagnostics may also enable confirmation of species identity where novel invasions of weed species beyond their normal range are suspected. One example used species diagnostic KASP markers to confirm the recent invasion into Brazil of populations of A. palmeri , distinguishing this species from the complex of other weedy Amaranthus species previously documented in Brazil . Increasing access to genomic resources and sequence data for closely related weed species will continue to enable and inform these efforts.…”

Section: Weed Genomics Provides Novel Insights Into Weed Biologymentioning

confidence: 99%

The power and potential of genomics in weed biology and management

Ravet

Patterson

Krähmer

et al. 2018

Pest Management Science

View full text Add to dashboard Cite

There have been previous calls for, and efforts focused on, realizing the power and potential of weed genomics for better understanding of weeds. Sustained advances in genome sequencing and assembly technologies now make it possible for individual research groups to generate reference genomes for multiple weed species at reasonable costs. Here, we present the outcomes from several meetings, discussions, and workshops focused on establishing an International Weed Genomics Consortium (IWGC) for a coordinated international effort in weed genomics. We review the 'state of the art' in genomics and weed genomics, including technologies, applications, and on-going weed genome projects. We also report the outcomes from a workshop and a global survey of the weed science community to identify priority species, key biological questions, and weed management applications that can be addressed through greater availability of, and access to, genomic resources. Major focus areas include the evolution of herbicide resistance and weedy traits, the development of molecular diagnostics, and the identification of novel targets and approaches for weed management. There is increasing interest in, and need for, weed genomics, and the establishment of the IWGC will provide the necessary global platform for communication and coordination of weed genomics research. © 2018 Society of Chemical Industry.

show abstract

Multiple Resistance to Glyphosate and Acetolactate Synthase Inhibitors in Palmer Amaranth (Amaranthus palmeri) Identified in Brazil

Cited by 60 publications

References 46 publications

Target‐site mutation accumulation among ALS inhibitor‐resistant Palmer amaranth

Target‐site mutation accumulation among ALS inhibitor‐resistant Palmer amaranth

Interspecific and intraspecific transference of metabolism‐based mesotrione resistance in dioecious weedy Amaranthus

The power and potential of genomics in weed biology and management

Contact Info

Product

Resources

About