Multiplex polymerase chain reaction for adenovirus and herpes simplex virus in eye swabs

Jackson, Raven; Morris, David J.; Cooper, Robert J.; Bailey, A. S.; Klapper, Paul E.; Cleator, Graham M.; Tullo, Andrew B.

doi:10.1016/0166-0934(95)01903-0

Cited by 37 publications

(32 citation statements)

References 11 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Consistent with what was reported in the early optimization experiments, detection in foods was more sensitive with the monoplex than with the multiplex NASBA system. Indeed, some investigators have found that the amplification efficiency of one target may decrease by 1 to 3 log 10 in the presence of excess competitive target (13,21). The reduced detection sensitivity of electrochemiluminescence compared to dot blot hybridization may be explained by differences in temperature and time used in the hybridization protocols or differences in the mechanisms and chemistries upon which detection of positive signals was based.…”

Section: Discussionmentioning

confidence: 99%

Multiplex Nucleic Acid Sequence-Based Amplification for Simultaneous Detection of Several Enteric Viruses in Model Ready-To-Eat Foods

Jean

D’Souza

Jaykus

2004

Appl Environ Microbiol

View full text Add to dashboard Cite

Human enteric viruses are currently recognized as one of the most important causes of food-borne disease. Implication of enteric viruses in food-borne outbreaks can be difficult to confirm due to the inadequacy of the detection methods available. In this study, a nucleic acid sequence-based amplification (NASBA) method was developed in a multiplex format for the specific, simultaneous, and rapid detection of epidemiologically relevant human enteric viruses. Three previously reported primer sets were used in a

show abstract

Section: Discussionmentioning

confidence: 99%

Multiplex Nucleic Acid Sequence-Based Amplification for Simultaneous Detection of Several Enteric Viruses in Model Ready-To-Eat Foods

Jean

D’Souza

Jaykus

2004

Appl Environ Microbiol

View full text Add to dashboard Cite

show abstract

“…Some affected patients revisited the casualty department repeatedly while awaiting viral culture results and therefore represented a potential infection source. More rapid diagnostic tests, for example, radioimmune dot blot testing and PCR, have been argued for by previous researchers, [19][20][21][22] with potential benefits in reducing the degree of spread of the viral transmission. This audit supports their findings.…”

Section: Discussionmentioning

confidence: 99%

“…Spread is via droplet or direct contact. The majority of virology departments currently use viral isolation by the culture of conjunctival swab samples to confirm infection, while the uptake of more rapid virological confirmation techniques [1][2][3][19][20][21][22] has been slow because of the increased cost and expertise required for their implementation.…”

Section: Introductionmentioning

confidence: 99%

Epidemic kerato-conjunctivitis—do outbreaks have to be epidemic?

Cheung

Bremner

Chan

2003

Eye

View full text Add to dashboard Cite

Purpose To study: the epidemiology of an outbreak of adenoviral keratoconjunctivitis in a UK teaching hospital; disease presentation and its effect on clinical diagnostic efficiency; patterns of viral transmission between staff and patients; the effectiveness of infection control procedures in minimising outbreaks.Methods Prospective/retrospective clinical audit and retrospective audit of virological culture results: all viral culture swabs taken during an outbreak of adenoviral keratoconjunctivitis were analysed. The case records of patients whose viral swabs were positive for adenoviral culture were traced.

show abstract

“…Then the DNA products used for polymerase chain reaction PCR technique, the adenovirus primers (P1 -5' GCCGCAGTGGTCTTACATGCACATC 3', P2 -5' CAGCACGCCGCGGATGTCAAGT 3') were designed according to the DNA sequence of the hexon region of adenoviruses types 2 and 5. This pair of primers amplifies a fragment of 300 bp from the hexon gene of many serotypes 22 . The PCR reaction was carried out as described elsewhere…”

Section: Methodsmentioning

confidence: 99%

Molecular Detection of Adenovirus type 2 among Conjunctivitis Patients in Khartoum State- Sudan

Shambal¹

2018

IJRASET

View full text Add to dashboard Cite

Background: Adenoviruses are a group of viruses that can infect the membranes (tissue linings) of the respiratory tract, eyes, intestines, and urinary tract. Diagnosis of conjunctivitis and differentiation between bacterial, viral, and noninfectious conjunctivitis are usually clinical. PCR and other rapid, office-based immunodiagnostic tests can be useful especially when the inflammation is severer. Objective: This study aimed to detect adenovirus among conjunctivitis infected patients to figure out the possibility of using PCR technique to achieve that goal. Methods: By using PCR for DNA products of 45 conjunctivitis swabs, to detect adenovirus type 2. The Results: Only one sample gave a positive result out of 45 samples detected (2.2%) Conclusion: It seems to be no adenovirus spreading enough among patients causing their eye illness, therefore other causative agents for conjunctivitis may be existence, as in Sudan most of the year the climate not suitable for adenovirus survival as it lives in cold and wet environments unlike what above local one. However, if any signs suggest bacterial conjunctivitis (eg, purulent discharge), cultures or other studies may be useful. The prevalence of adenoviral conjunctivitis in the study population was lower than the prevalence in other regions of the world.

show abstract

Multiplex polymerase chain reaction for adenovirus and herpes simplex virus in eye swabs

Cited by 37 publications

References 11 publications

Multiplex Nucleic Acid Sequence-Based Amplification for Simultaneous Detection of Several Enteric Viruses in Model Ready-To-Eat Foods

Multiplex Nucleic Acid Sequence-Based Amplification for Simultaneous Detection of Several Enteric Viruses in Model Ready-To-Eat Foods

Epidemic kerato-conjunctivitis—do outbreaks have to be epidemic?

Molecular Detection of Adenovirus type 2 among Conjunctivitis Patients in Khartoum State- Sudan

Contact Info

Product

Resources

About