Natural Competence in the Hyperthermophilic ArchaeonPyrococcus furiosusFacilitates Genetic Manipulation: Construction of Markerless Deletions of Genes Encoding the Two Cytoplasmic Hydrogenases

Abstract

In attempts to develop a method of introducing DNA into Pyrococcus furiosus, we discovered a variant within the wild-type population that is naturally and efficiently competent for DNA uptake. A pyrF gene deletion mutant was constructed in the genome, and the combined transformation and recombination frequencies of this strain allowed marker replacement by direct selection using linear DNA. We have demonstrated the use of this strain, designated COM1, for genetic manipulation. Using genetic selections and counterselections based on uracil biosynthesis, we generated single-and double-deletion mutants of the two gene clusters that encode the two cytoplasmic hydrogenases. The COM1 strain will provide the basis for the development of more sophisticated genetic tools allowing the study and metabolic engineering of this important hyperthermophile.It would be difficult to overestimate the contribution of genetic manipulation to the study of any biological system, and it is an essential tool for the metabolic engineering of biosynthetic and substrate utilization pathways. This is particularly true for the archaea since, in spite of their environmental and industrial importance, coupled with their unique molecular features, much remains to be learned about their biology (2). The marine hyperthermophilic anaerobe Pyrococcus furiosus is of special interest not only for its ability to grow optimally at 100°C and the implications of this trait for its biology but also for industrial applications of its enzymes, as well as its capacity to produce hydrogen efficiently (4, 13, 44). The ability to apply genetic analyses of P. furiosus to underpin existing biochemical and molecular studies will contribute greatly to the establishment of P. furiosus as a model organism, particularly for biological hydrogen production.The development of genetic systems in the archaea, in general, presents many unique challenges given the extreme growth requirements of many of these organisms. To date, genetic systems of various levels of sophistication have been developed for representatives of all major groups of archaea, including halophiles, methanogens, thermoacidophiles, and hyperthermophiles (2,6,30,40,43,46). A variety of transformation methods are being used, including electroporation, heat shock with or without CaCl 2 treatment, phage-mediated transduction, spheroplast transformation, liposomes, and, very recently, even conjugation with Escherichia coli (2, 12). Transformation via natural competence has been reported in three archaeal species, in comparison to over 60 bacterial species that are known to exhibit this trait (16,36). Two of them are the methanogens Methanococcus voltae PS (7, 27) and Methanobacterium thermoautotrophicum Marburg (47); however, transformation frequencies were low, and there have been no follow-up studies regarding natural competence. The other is the hyperthermophile Thermococcus kodakarensis, which has an optimal growth temperature of 85°C. Its natural competence has enabled the development of genetic tools fo...

A broadly applicable gene knockout system for the thermoacidophilic archaeon Sulfolobus islandicus based on simvastatin selection

“…Unlike what has been observed in other species (Lipscomb et al, 2011), this indicates a very low spontaneous mutation rate to simvastatin resistance. There are three main factors that led to our low number of initial transformants.…”

“…There are three main factors that led to our low number of initial transformants. First, unlike Thermococcus kodakarensis and Pyrococcus furious, which display strong natural competence (Lipscomb et al, 2011;Sato et al, 2003Sato et al, , 2005, electroporation is the only effective way for the exogenous DNA to be introduced into S. islandicus strains. Most of the cells would be killed after electroporation and the relatively lower transformation efficiency [0-5 colonies (mg DNA) 21 for a circular knockout plasmid] usually result in a failure to obtain transformants, particularly when using a gene knockout plasmid for transformation (Deng et al, 2009).…”

“…In such a selection system, simvastatin, a competitive inhibitor of the 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase, was utilized to select for overexpression of the HMG-CoA reductase gene (hmgA) under the control of a strong constitutive promoter of glutamate dehydrogenase (Matsumi et al, 2007;Santangelo et al, 2008). This selection strategy has now been exploited in another hyperthermophilc euryarchaeon, Pyrococcus furious (optimal temperature 100 u C), with great success (Lipscomb et al, 2011;Waege et al, 2010). Recently, simvastatin has been used to rescue lethal deletion mutants in S. islandicus by transformation with a shuttle vector overexpressing HMG-CoA reductase from Sulfolobus tokodaii under the control of a constitutive promoter from S. acidocaldarius 7d (Zheng et al, 2012).…”

Exploiting microbial hyperthermophilicity to produce an industrial chemical, using hydrogen and carbon dioxide

“…A 65-b sequence of the 3′ end of the marker cassette (5′-ctaaaaaagattttatcttgagctccattctttcacctcctcgaaaatcttcttagcggcttccc) was repeated at the beginning of the cassette to serve as a homologous recombination region for selection of marker removal (27). Plasmid pGL007 targeting homologous recombination at the PF0574-PF0575 intergenic space was constructed by cloning the SOE-PCR product into plasmid pJHW006 (28) (Fig. S2).…”

“…S3), for targeted insertion of the SP1 operon at the PF0574-PF0575 intergenic space. Transformation of P. furiosus ΔpdaD strain was performed as previously described for COM1 (28), except that the defined medium contained maltose instead of cellobiose as the carbon source and was supplemented with 0.1% wt/vol casein hydrolysate. Transformation of P. furiosus strain COM1 was performed as previously described (28), except that linear plasmid DNA was used for transformation.…”