New evidence on tick-borne rickettsioses in the Altai region of Russia using primary lesions, serum and blood clots of molecular and serological study

Гранитов, В. М.; Шпынов, С. Н.; Beshlebova, Olga; Arsenjeva, Irina; Dedkov, Vladimir G.; Safonova, Marina V.; Стуколова, О. А.; Pantjukhina, Anna; Тарасевич, И. В.

doi:10.1016/j.micinf.2015.08.011

Cited by 14 publications

(5 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…В результате применения этого подхода ДНК «классического» патогенного вида -R. sibirica выявлена в клещах D. nuttalli и H. concinna в Республике Алтай, клещах D. silvarum, H. concinna и H. japonica douglasi в Хабаровском крае. В то же время при генотипировании риккетсий в пробах клинического материала от пациентов в очагах СКТ в Республике Алтай, Алтайском и Хабаровском краях удалось выявить ДНК R. sibirica и R. heilongjiangensis [12,13,16]. При этом на территории Новосибирской области в пробах клинического материала от пациентов с подозрением на «клещевые» инфекции ДНК R. sibirica выявлялась в 2,3 раза чаще, чем R. raoultii [14].…”

Section: результатыunclassified

Genotyping of rickettsias circulating in the territories of the Altai Republic and Khabarovsk krai

Штрек

Рудаков

Шпынов

et al. 2023

Russian Journal of Infection and Immunity

View full text Add to dashboard Cite

The aim of the study was to verificate of the causative agent of Siberian tick-borne typhus (STT) upon ixodic tick mixed infection on the territory of the Altai Republic and Khabarovsk Krai using an integrated molecular biological approach. Materials and methods. The material for the study was presented as 304 imago of ixodic mites of six species. The ticks were collected on the territory of the Altai Republic and the Khabarovsk Krai in the years 20142022. Rickettsia DNA was identified by two-round PCR using genus- and species-specific primers for gltA and ompA genes, followed by sequencing and using PCR reagent kits RealBest DNA R. sibirica/R. heilongjiangensis (Vector-Best, Novosibirsk). Results. The detection of rickettsia in ticks in the Altai Republic was 82.6% (CI: 69.196.1), in the Khabarovsk Krai 53.1% (CI: 44.961.3). The species composition of rickettsias in various species of ixodic mites in these territories, endemic to Siberian tick typhus, is characterized by the presence of mixed forms. Rickettsia sibirica and R. raoultii were found in ticks Dermacentor nuttalli, Haemaphysalis concinna, D. silvarum. Only Candidatus R. tarasevichiae were detected in Ixodes persulcatus, I. pavlovsky mites and I. pavlovsky/persulcatus hybrids. The DNA of R. heilongjiangensis was found in H. mites. concinna in the Khabarovsk Krai. The DNA of Candidatus R. tarasevichiae is also present in the ticks of D. nuttalli and H. concinna from the Altai Republic. The DNA of the classic pathogenic species, R. sibirica, was detected in ticks D. nuttalli and H. concinna in the Altai Republic, ticks D. silvarum, H. concinna and H. japonica douglasi in the Khabarovsk Krai. In addition, in the Khabarovsk Krai, the DNA of R. heilongjiangensis was detected in H. concinna ticks, and a DNA fragment common to R. sibirica subsp. mongolitimonae and R. conorii was detected in H. japonica douglasi ticks, which requires further study. Candidatus R. tarasevichiae is common in Ixodes mites (I. persulcatus, I. pavlovsky and their hybrids), in the Altai Republic in D. nuttalli and H. concinna. R mites. raoultii was detected in ticks of the genus Dermacentor D. nuttalli in the Altai Republic and D. silvarum in the Khabarovsk Krai. Conclusions. During molecular biological monitoring of rickettsias in endemic territories, the detection of R. raoultii masks the presence of the etiological agent of STT R. sibirica. This phenomenon makes it possible to explain the high incidence of STT in the studied territories, with the rare detectability of R. sibirica DNA during molecular biological screening in ixodic mites.

show abstract

Section: результатыunclassified

Genotyping of rickettsias circulating in the territories of the Altai Republic and Khabarovsk krai

Штрек

Рудаков

Шпынов

et al. 2023

Russian Journal of Infection and Immunity

View full text Add to dashboard Cite

show abstract

“…tarasevichiae», поражают главным образом сосуды головного мозга [5]. 1087 52 [7] Двухраундовая glt3 (tatagacggtgataaaggaatc) glt4 (cagaactaccgatttctttaagc)…”

Section: резюмеunclassified

“…Двухраундовая RT1 (tactaaaaaagtcgctgttcattc) RT2 (tgttgcaaacatcatgcgtaag) 300 56 [7] РГКПЛ gltA Двухраундовая RH1 (gtcagtctactatcacctatatag) RH3 (taaaatattcatctttaagagcga)…”

Section: Tarasevichiae' Gltaunclassified

See 1 more Smart Citation

Clinical and laboratory characteristics of tick-borne rickettsiosis related to <i>Rickettsia sibirica</i> and <i>Candidatus Rickettsia tarasevichiae</i>

Рудаков

Samoylenko

Штрек

et al. 2021

Russian Journal of Infection and Immunity

View full text Add to dashboard Cite

The Siberian tick-borne typhus (STT) is the most common tick-borne rickettsiosis (TBR) in Russia, registered in 17 administrative territories of the Southern Siberia and the Far East. The aim of this study was to describe clinical picture, pathological data and the results of laboratory diagnostics during fatal mixed infection caused by two rickettsia species most common in Russia - pathogenic Rickettsia sibirica and poorly examined Candidatus R. tarasevichiae, including identification of its etiological agents.A four-year-old girl in the Krasnoyarsk Territory in a hyperendemic focus of the Siberian tick-borne typhus after tick sucking revealed typical TBR symptoms (scab at the site of tick suction, fever, spotted rash, myalgia) and meningeal syndrome, which is not typical for the Siberian tick-borne typhus. The child died on the seventh day of the illness. Autopsy data (hepatosplenomegaly; cerebral edema, which was the immediate cause of death) and the results of histological examination (productive vasculitis of the brain, spinal cord and skin, polymorphic cell perivascular infiltrates in the liver and lungs, serous meningitis, myeloid hyperplasia of the spleen and lymph nodes, interstitial lymphoid infiltration in the myocardium) confirmed the clinical diagnosis of tick-borne rickettsiosis.The patient's blood and brain samples were tested for a wide range of tick-borne pathogens and enteric viruses that cause brain damage using PCR followed by sequencing of the positive samples.The DNA of Rickettsia sibirica and "Candidatus Rickettsia tarasevichiae" was found in both blood and brain samples. R. sibirica was identified by the nucleotide sequences of gene fragments gltA, OmpA and ompB, and "Candidatus R. tarasevichiae" - the gltA and ompB genes using nested PCR and sequencing. All amplified fragments were sequenced in both directions; the obtained sequences were deposited in the GenBank database under the inventory numbers: MK048467-MK048475. We have not identified other tick-borne pathogens or intestinal viruses in the patient samples able to result in meningeal syndrome.The area where the child was sucked by the tick belongs to the regions with a high incidence of STT. Several species of mites coexist in this area; of these, Haemaphisalis concinna, the carrier of R. sibirica, dominates the populations of Ixodes mites, while Ixodes persulcatus, the main reservoir of "Candidatus R. tarasevichiae", is less common.As a result of the conducted studies, for the first time in the Russian Federation, a verified case of a lethal infection associated with two species of rickettsiae - Rickettsia sibirica and "Candidatus R. tarasevichiae" was identified and described.

show abstract

“…Siberian tick typhus (STT) caused by Rickettsia sibirica was previously considered to be the only tick-borne rickettsiosis in the Asian part of Russia [2]. However, recently, Rickettsia heilongjiangensis also has been isolated from humans in that region [4,5]. The clinical manifestations of rickettsioses caused by these two species are similar, and although the aetiological agents can be distinguished using genetics, this has been accomplished in only a limited number of cases [4e7].…”

Section: Introductionmentioning

confidence: 99%

Detection of causative agents of tick-borne rickettsioses in Western Siberia, Russia: identification of Rickettsia raoultii and Rickettsia sibirica DNA in clinical samples

Igolkina

Краснова

Рар

et al. 2018

Clinical Microbiology and Infection

View full text Add to dashboard Cite

show abstract

New evidence on tick-borne rickettsioses in the Altai region of Russia using primary lesions, serum and blood clots of molecular and serological study

Cited by 14 publications

References 9 publications

Genotyping of rickettsias circulating in the territories of the Altai Republic and Khabarovsk krai

Genotyping of rickettsias circulating in the territories of the Altai Republic and Khabarovsk krai

Clinical and laboratory characteristics of tick-borne rickettsiosis related to <i>Rickettsia sibirica</i> and <i>Candidatus Rickettsia tarasevichiae</i>

Detection of causative agents of tick-borne rickettsioses in Western Siberia, Russia: identification of Rickettsia raoultii and Rickettsia sibirica DNA in clinical samples

Contact Info

Product

Resources

About