New PCR–RFLP diagnostics methodology for detecting Varroa destructor resistant to synthetic pyrethroids

Millán-Leiva, Anabel; Hernández‐Rodríguez, Carmen Sara; González‐Cabrera, Joel

doi:10.1007/s10340-018-0964-2

Cited by 16 publications

(15 citation statements)

References 20 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Genomic DNA was purified using a genomic DNA mini kit (Geneaid, New Taipei, Taiwan) and then frozen (−40 °C) until further analysis. Detection of the L925V mutation was based on a PCR–RFLP protocol . The PCR master mix consisted of 1.25 U of LA polymerase (Top‐Bio, Prague, Czechia), 200 μM dNTPs, 3 mM MgCl 2 , 100 nM primers (v1440f: 5′‐ATTAGGTCTTTGCCATTGCTA‐3′ and v2022r: 5′‐CTCCTTCCATACGCTATATGC‐3′), and 8.5 ng of genomic DNA.…”

Section: Methodsmentioning

confidence: 99%

“…Earlier bioassay studies documented V. destructor resistance to tau ‐fluvalinate in Italy during the 1990s, along with its subsequent spread throughout the European Union and the USA . Unfortunately, these studies did not focus on the mechanism of resistance and could not confirm the resistance or identify heterozygotes . Such information can now be readily obtained using diagnostic methods based on polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP).…”

Section: Introductionmentioning

confidence: 99%

“…Such information can now be readily obtained using diagnostic methods based on polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP). This technique can specifically detect mutations at position 925 of the sodium channel gene and provide sufficient resolution to verify whether sensitive/resistant mites are homozygotes or heterozygotes …”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Spatio‐temporal dynamics of Varroa destructor resistance to tau‐fluvalinate in Czechia, associated with L925V sodium channel point mutation

Stará

Pekár

Nešvorná

et al. 2018

Pest Management Science

View full text Add to dashboard Cite

BACKGROUND: Extensive application of pyrethroids to control Varroa destructor, an invasive mite devastating bee colonies, has resulted in a global spread of resistant mite populations. In this study, we analyzed the spatio-temporal dynamics of resistant V. destructor populations in Czechia, stemming from the L925V mutation. Mites were collected during 2011-2018 directly or from winter beeswax debris, and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and densitometry was used to detect the L925V mutation.RESULTS: Pooled samples of 10 mites were classified, based on their PCR-RFLP patterns, as tau-fluvalinate-sensitive (56%), resistant (9%), or mixed (35%), with the latter including sensitive and resistant homo-and heterozygotes. We identified two zones with higher frequencies of resistance, one in southern Moravia and the other in Bohemia. The mutant populations were evenly distributed throughout the monitored districts, with a few temporal and spatial local fluctuations. The greatest increase in resistance was observed in 2016, following massive losses of bee colonies in the winter of 2015. This event appeared to be closely associated with fluctuations in resistant mite populations and their dispersion. CONCLUSION: Two outbreaks of resistance were detected in Czechia; however, the amount of applied tau-fluvalinate was not correlated with the frequency of resistance in mites. There was no remarkable increase in mite resistance in 2011-2018, although the use of tau-fluvalinate increased 40-fold between 2011 and 2015. PCR-RFLP analysis, performed on mites present in beeswax debris, is a suitable method for monitoring the L925V mutation in V. destructor.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Spatio‐temporal dynamics of Varroa destructor resistance to tau‐fluvalinate in Czechia, associated with L925V sodium channel point mutation

Stará

Pekár

Nešvorná

et al. 2018

Pest Management Science

View full text Add to dashboard Cite

show abstract

“…Varroa resistance to fluvalinate is now widespread [82], due to DNA mutations [83,84]. Molecular tools have been developed to detect this resistance in Varroa populations [85,86]. A provisional solution to limit and temporally bypass Varroa resistance to miticides is to switch between molecules with different molecular targets.…”

Section: Chemical Controlmentioning

confidence: 99%

Varroa destructor: how does it harm Apis mellifera honey bees and what can be done about it?

Noël

Conte

Mondet

2020

Emerging Topics in Life Sciences

View full text Add to dashboard Cite

Since its migration from the Asian honey bee (Apis cerana) to the European honey bee (Apis mellifera), the ectoparasitic mite Varroa destructor has emerged as a major issue for beekeeping worldwide. Due to a short history of coevolution, the host–parasite relationship between A. mellifera and V. destructor is unbalanced, with honey bees suffering infestation effects at the individual, colony and population levels. Several control solutions have been developed to tackle the colony and production losses due to Varroa, but the burden caused by the mite in combination with other biotic and abiotic factors continues to increase, weakening the beekeeping industry. In this synthetic review, we highlight the main advances made between 2015 and 2020 on V. destructor biology and its impact on the health of the honey bee, A. mellifera. We also describe the main control solutions that are currently available to fight the mite and place a special focus on new methodological developments, which point to integrated pest management strategies for the control of Varroa in honey bee colonies.

show abstract

“…Surveys to monitor mutations associated with resistance have resulted in increased management success of pest species like mosquitoes, aphids, beetles and ticks [58][59][60][61][62][63] . These efforts take advantage of the several methodologies currently available for detecting resistant alleles in arthropod pests 47,58,64,65 . In case of V. destructor, we have previously designed and tested a high throughput allelic discrimination assay based on TaqMan®.…”

Section: Introductionmentioning

confidence: 99%

Mutations associated with pyrethroid resistance in Varroa mites, a parasite of honey bees, are widespread across the USA

Millán-Leiva

Marín

Christmon

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

BACKGROUNDManaged honey bees are key pollinators of many crops and play an essential role in the United States food production. For more than 10 years, beekeepers in the US have been reporting high rate of colony losses. One of the drivers of this colony loss is the parasitic mite Varroa destructor. Preserving healthy honey bee colonies in the US is dependent on a successful control of this mite. The pyrethroid tau-fluvalinate (Apistan®) was among the first synthetic varroacide registered in the US. With over 20 years of use, population of mites resistant to Apistan® have emerged, and so it is unsurprising that treatment failures have been reported. Resistance in US mite populations to tau-fluvalinate is associated with point mutations at position 925 of the voltage-gated sodium channel, L925I and L925M.RESULTSHere, we have generated a distribution map of pyrethroid resistance alleles in Varroa samples collected from US apiaries in 2016 and 2017, using a high throughput allelic discrimination assay based on TaqMan®. Our results evidence that these kdr-type mutations are widely distributed in Varroa populations across the country showing high variability among apiaries.CONCLUSIONWe highlight the relevance of monitoring the resistance in mite populations to achieve an efficient control of this pest, and the benefit of implementing this methodology in pest management programs for varroosis.

show abstract

New PCR–RFLP diagnostics methodology for detecting Varroa destructor resistant to synthetic pyrethroids

Cited by 16 publications

References 20 publications

Spatio‐temporal dynamics of Varroa destructor resistance to tau‐fluvalinate in Czechia, associated with L925V sodium channel point mutation

Spatio‐temporal dynamics of Varroa destructor resistance to tau‐fluvalinate in Czechia, associated with L925V sodium channel point mutation

Varroa destructor: how does it harm Apis mellifera honey bees and what can be done about it?

Mutations associated with pyrethroid resistance in Varroa mites, a parasite of honey bees, are widespread across the USA

Contact Info

Product

Resources

About