New universal ITS2 primers for high-resolution herbivory analyses using DNA metabarcoding in both tropical and temperate zones

Abstract

DNA metabarcoding is a rapidly growing technique for obtaining detailed dietary information. Current metabarcoding methods for herbivory, using a single locus, can lack taxonomic resolution for some applications. We present novel primers for the second internal transcribed spacer of nuclear ribosomal DNA (ITS2) designed for dietary studies in Mauritius and the UK, which have the potential to give unrivalled taxonomic coverage and resolution from a short-amplicon barcode. In silico testing used three databases of plant ITS2 sequences from UK and Mauritian floras (native and introduced) totalling 6561 sequences from 1790 species across 174 families. Our primers were well-matched in silico to 88% of species, providing taxonomic resolution of 86.1%, 99.4% and 99.9% at the species, genus and family levels, respectively. In vitro, the primers amplified 99% of Mauritian (n = 169) and 100% of UK (n = 33) species, and co-amplified multiple plant species from degraded faecal DNA from reptiles and birds in two case studies. For the ITS2 region, we advocate taxonomic assignment based on best sequence match instead of a clustering approach. With short amplicons of 187–387 bp, these primers are suitable for metabarcoding plant DNA from faecal samples, across a broad geographic range, whilst delivering unparalleled taxonomic resolution.

Development of conventional PCR and real‐time PCR assays to discriminate the origins of Chinese pepper oil and herbal materials from Zanthoxylum

“…In some plant taxa, however, this approach is of limited usefulness for species identification due to sequence variation in the universal primer regions, as well as the secondary structure of the genome . Despite the fact that ITS (or ITS2) exhibits poor PCR amplification in some plant taxa, it can be used for higher‐resolution species identification than other DNA barcode regions …”

Quantitative and qualitative assessment of pollen DNA metabarcoding using constructed species mixtures

“…; Moorhouse‐Gann et al. ). Based on the sequencing results obtained for the single‐species pollen samples, no primer biases were substantial enough to prevent amplification entirely.…”

“…Some potential quantitative biases in DNA metabarcoding include isolation bias, preservation bias, amplification bias and copy number bias (Brooks et al., ; Bell, Burgess, et al., ; Pornon et al., ; Moorhouse‐Gann et al. ). If these biases are relatively small, or there are negative correlations among biases, metabarcoding could give mostly reliable quantitative results.…”

A diet rich in C3 plants reveals the sensitivity of an alpine mammal to climate change

“…We amplified the ITS2 region of plant nuclear DNA using primer pair UniPlantF (5′‐TGTGAATTGCARRATYCMG‐3′) and UniPlantR (5′‐CCCGHYTGAYYTGRGGTCDC‐3′; 187–380 bp; Moorhouse‐Gann et al., ) and the rbcL region of chloroplast DNA using primer pair rbcL a‐F (5′ ATGTCACCACAAACAGAGACTAAAGC‐3′ and rbcL a‐R (5′‐GTAAAATCAAGTCCACCRCG‐3′; 553 bp; Levin et al., ; Kress et al., ; Yoccoz et al., ). Primers had overhang adapter sequences added to the 5′ end for the initial PCR amplification, following Campbell, Harmon, and Narum ().…”

“…For ITS2, filtered sequences were then aligned using FLASH (Magoč & Salzberg, ), aligned sequences with matches to the ITS2 primer sequences only were extracted, and primer sequences were removed using the “trim_seqs” command in Mothur (Schloss et al., ). The ITS2 region was extracted from the whole amplicon sequence (which includes ~73 bp of 5.8S rDNA sequence, Moorhouse‐Gann et al., ) using ITSx (Bengtsson‐Palme et al., ). The “derep_fulllength” and “uchime2_denovo” commands were used in usearch software v 9.2.64 (Edgar, ) to eliminate all sequences which had less than 10 copies per sample and any chimeric sequences.…”