Non-Invasive Genotyping of Honey Bee Queens Apis mellifera L.: Transition of the DraI mtDNA COI-COII Test to In Silico

Madella, Shayne; Grubbs, Kyle; Alburaki, Mohamed

doi:10.3390/insects12010019

Cited by 7 publications

(17 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…A single leg was dissected from each bee sample and the DNA was extracted in 96-well PCR plates using the Chelex method ( Walsh et al, 2013 ) with slight modifications ( Madella et al, 2021 ). Each leg was individually placed in a plate well and 100 μ L of warm (60°C) and constantly stirred 10% Chelex solution (w/v) was added to each plate well.…”

Section: Methodsmentioning

confidence: 99%

“…The intergenic non-coding region of the mtDNA located between the cytochrome oxidase I and II genes was amplified using a new set of validated primers ( Madella et al, 2021 ) and captured the full sequence length of the COI-COII region: COI_Seq-F: ACCACCTCTAGATCATTCACATTT, COII_Seq-R: AGGATGGAACTGTTCATGAATGAA. This PCR amplification was conducted in a 14 μ L reaction mixture that included 6 μ L of Bio-Rad’s Master Mix for PCR (2X), 0.5 μ L of each primer (10 μ M), 5 μ L nuclease-free water and 2 μ L of DNA.…”

Section: Methodsmentioning

confidence: 99%

“…Unfortunately, a significant number of available COI-COII sequences on NCBI do not meet this criterion and come short at both 5′ and 3′ ends of this region. Our previous study discussed this challenge ( Madella et al, 2021 ). Therefore, among all available COI-COII sequences found on NCBI, a local database exclusively made of verified sequences with complete length was created.…”

Section: Methodsmentioning

confidence: 99%

“…The honey bee evolutionary lineages were determined based on the genetic structure of the intergenic region detailed in previous studies ( Cornuet et al, 1991 ; Smith et al, 1991 ; Garnery et al, 1992 ; Garnery et al, 1993 ; Alburaki et al, 2011 ). In order to identify the evolutionary lineages and haplotypes, the DmCC test was conducted in silico on all the COI-COII sequences (n = 1,062) following the steps described in ( Madella et al, 2021 ) using Geneious Prime software. Briefly, the sequences were grouped based on the structure and length of the intergenic region, aligned and trimmed at the exact 5′ and 3’ ends of the E2 and H2 primers, annotated and subjected to in silico Dra I restriction.…”

Section: Methodsmentioning

confidence: 99%

“…Nonetheless, significant discrepancies concerning haplotype naming and identity have arisen among these investigations, further complicating honey bee phylogeographic analyses. In order to reconcile such discrepancies, an in silico DmCC test was proposed and tested in a recent study ( Madella et al, 2021 ).…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

Honey bee populations of the USA display restrictions in their mtDNA haplotype diversity

Alburaki¹,

Madella²,

Lopez³

et al. 2023

Front. Genet.

Self Cite

View full text Add to dashboard Cite

The genetic diversity of the USA honey bee (Apis mellifera L.) populations was examined through a molecular approach using two mitochondrial DNA (mtDNA) markers. A total of 1,063 samples were analyzed for the mtDNA intergenic region located between the cytochrome c oxidase I and II (COI-COII) and 401 samples were investigated for the NADH dehydrogenase 2 (ND2) coding gene. The samples represented 45 states, the District of Colombia and two territories of the USA. Nationwide, three maternal evolutionary lineages were identified: the North Mediterranean lineage C (93.79%), the West Mediterranean lineage M (3.2%) and the African lineage A (3.01%). A total of 27 haplotypes were identified, 13 of them (95.11%) were already reported and 14 others (4.87%) were found to be novel haplotypes exclusive to the USA. The number of haplotypes per state/territory ranged between two and eight and the haplotype diversity H ranged between 0.236–0.763, with a nationwide haplotype diversity of 0.597. Furthermore, the honey bee populations of the USA were shown to rely heavily (76.64%) on two single haplotypes (C1 = 38.76%, C2j = 37.62%) of the same lineage characterizing A. m. ligustica and A. m. carnica subspecies, respectively. Molecular-variance parsimony in COI-COII and ND2 confirmed this finding and underlined the central and ancestral position of C2d within the C lineage. Moreover, major haplotypes of A. m. mellifera (M3a, M7b, M7c) were recorded in six states (AL, AR, HI, MO, NM and WA). Four classic African haplotypes (A1e, A1v, A4, A4p) were also identified in nine states and Puerto Rico, with higher frequencies in southern states like LA, FL and TX. This data suggests the need to evaluate if a restricted mtDNA haplotype diversity in the US honey bee populations could have negative impacts on the beekeeping sustainability of this country.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Honey bee populations of the USA display restrictions in their mtDNA haplotype diversity

Alburaki¹,

Madella²,

Lopez³

et al. 2023

Front. Genet.

Self Cite

View full text Add to dashboard Cite

show abstract

Algerian Propolis from Distinct Geographical Locations: Chemical Profiles, Antioxidant Capacity, Cytotoxicity and Inhibition of 5‐Lipoxygenase Product Biosynthesis

Ayad,

Hébert,

Doiron

et al. 2024

Chemistry & Biodiversity

Self Cite

View full text Add to dashboard Cite

Propolis was collected from honeybee hives in three geographically distinct Algerian climates and extracts were characterized for composition and bioactivity. Bees were identified as native subspecies using an in‐silico DraI mtDNA COI‐COII test. Over 20 compounds were identified in extracts by LC‐MS. Extracts from the Medea region were more enriched in phenolic content (302 ± 28 mg GAE/g of dry extract) than those from Annaba and Ghardaia regions. Annaba extracts had the highest flavonoid content (1870 ± 385 mg QCE/g of dry extract). Medea extracts presented the highest free‐radical scavenging activity (IC50 = 13.5 µg/mL) using the DPPH radical assay while Ghardaia extracts from the desert region were weak (IC50 > 100 µg/mL). Antioxidant activities measured using AAPH oxidation of linoleic acid were similar in all extracts with IC50 values ranging from 2.9 to 4.9 µg/mL. All extracts were cytotoxic (MTT assay) and proapoptotic (Annexin‐V) against human leukemia cell lines in the low µg/mL range, although the Annaba extract was less active against the Reh cell line. Extracts inhibited cellular 5‐lipoxygenase product biosynthesis with IC50 values ranging from 0.6 to 3.2 µg/ml. Overall, examined propolis extracts exhibited significant biological activity that warrant further characterization in cellular and in vivo models.

show abstract

Identification of runs of homozygosity in Western honey bees (Apis mellifera) using whole‐genome sequencing data

Gmel

Guichard

Dainat

et al. 2023

Ecology and Evolution

View full text Add to dashboard Cite

Runs of homozygosity (ROH) are continuous homozygous segments that arise through the transmission of haplotypes that are identical by descent. The length and distribution of ROH segments provide insights into the genetic diversity of populations and can be associated with selection signatures. Here, we analyzed reconstructed whole‐genome queen genotypes, from a pool‐seq data experiment including 265 Western honeybee colonies from Apis mellifera mellifera and Apis mellifera carnica. Integrating individual ROH patterns and admixture levels in a dynamic population network visualization allowed us to ascertain major differences between the two subspecies. Within A. m. mellifera, we identified well‐defined substructures according to the genetic origin of the queens. Despite the current applied conservation efforts, we pinpointed 79 admixed queens. Genomic inbreeding (FROH) strongly varied within and between the identified subpopulations. Conserved A. m. mellifera from Switzerland had the highest mean FROH (3.39%), while queens originating from a conservation area in France, which were also highly admixed, showed significantly lower FROH (0.45%). The majority of A. m. carnica queens were also highly admixed, except 12 purebred queens with a mean FROH of 2.33%. Within the breed‐specific ROH islands, we identified 14 coding genes for A. m. mellifera and five for A. m. carnica, respectively. Local adaption of A. m. mellifera could be suggested by the identification of genes involved in the response to ultraviolet light (Crh‐BP, Uvop) and body size (Hex70a, Hex70b), while the A. m. carnica specific genes Cpr3 and Cpr4 are most likely associated with the lighter striping pattern, a morphological phenotype expected in this subspecies. We demonstrated that queen genotypes derived from pooled workers are useful tool to unravel the population dynamics in A. mellifera and provide fundamental information to conserve native honey bees.

show abstract

Non-Invasive Genotyping of Honey Bee Queens Apis mellifera L.: Transition of the DraI mtDNA COI-COII Test to In Silico

Cited by 7 publications

References 34 publications

Honey bee populations of the USA display restrictions in their mtDNA haplotype diversity

Honey bee populations of the USA display restrictions in their mtDNA haplotype diversity

Algerian Propolis from Distinct Geographical Locations: Chemical Profiles, Antioxidant Capacity, Cytotoxicity and Inhibition of 5‐Lipoxygenase Product Biosynthesis

Identification of runs of homozygosity in Western honey bees (Apis mellifera) using whole‐genome sequencing data

Contact Info

Product

Resources

About