Non-invasive methods for identifying oocysts of Sarcocystis spp. from definitive hosts

Xiang, Zheng; Chen, Xinwen; Yang, Lei; He, Yongshu; Runsheng, Jiang; Rosenthal, Benjamin M.; Luan, Peng-tao; Attwood, Stephen W.; Zuo, Yang-Xian; Zhang, Yaping; Zhou, Yang

doi:10.1016/j.parint.2009.03.004

Cited by 33 publications

(31 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Ribosomal DNA sequences are the most common molecular markers used in Sarcocystis spp. differentiation (Dahlgren and Gjerde, 2008;Rosenthal et al, 2008;Xiang et al, 2009).…”

Section: Introductionmentioning

confidence: 99%

Molecular Identification and Prevalence of Sarcocystis Suihominis in Pork Meat Intended for Public Consumption

Fat¹,

Tăbăran²,

Dan³

et al. 2017

BUASVMCN-VM

View full text Add to dashboard Cite

Protozoa of the genus Sarcocystis are among the most prevalent parasitic forms found in pork. In order to rapidly assess the risk that this protozoa produceÂ in human population, a molecular method to detect and identify Sarcocystis suihominis needs to be implemented. The study aimed at characterizing the prevalence of Sarcocystis suihominis in pork obtained in the traditional households through PCR - RFLP method. The material was represented by seventy nine samples of diaphragmatic pillars collected between the periodÂ October 2014 - December 2014 from two local sanitary veterinary units from Alba and Cluj. The samples were processed first by trichinelloscopic compression method. All the positive fragments for Sarcocystis spp. were examined through PCR-RFLP method. The method used in the present study utilized the AluI restriction enzyme and had successfully differentiate the Sarcocystis suihominis from other Sarcocystis spp. prevalent in pork meat.Â The inspection of compressed muscle tissue has detected the presence of Sarcocystis suihominis in a high percentage of investigated samples. The prevalence of Sarcocystis suihominis in the examined samples was 26.58%. According to this result we can affirm that the risk of contamination in humans with Sarcocystis suihominis is high through consumption of contaminated pork meat, raised in the traditional system. In the present scientific research, we demonstrated that this method used for molecular identification of Sarcocystis suihominis has high accuracy and can be successfully applied for obtaining a certain diagnostic.

show abstract

“…Ribosomal DNA sequences are the most common molecular markers used in Sarcocystis spp. differentiation (Dahlgren and Gjerde, 2008;Rosenthal et al, 2008;Xiang et al, 2009).…”

Section: Introductionmentioning

confidence: 99%

Molecular Identification and Prevalence of Sarcocystis Suihominis in Pork Meat Intended for Public Consumption

Fat¹,

Tăbăran²,

Dan³

et al. 2017

BUASVMCN-VM

View full text Add to dashboard Cite

show abstract

“…Occurrence of microscopic cysts in cardiac muscle of various animal species, infected with Sarcocystis spp., is more frequent than a possible presence of macroscopic cysts in the same tissue (LATIF et al, 1999). There are four Sarcocystis species that are reported in sheep, two of them transmitted by canids and form microscopic cysts (S. tenella and S. arieticanis), and the other two transmitted by felines (S. gigantea and S. medusiformis) and form macroscopic cysts (DUBEY & LINDSAY, 2006;TITILINCU et al, 2008).…”

Section: Discussionmentioning

confidence: 99%

“…This may be because the sample volume used for nucleic acids extraction (50mg) was insufficient to detect parasitic DNA, as the concentration of tissue cysts is random, or because PCR assay presents a reduced ability to detect positive samples. PCR sensitivity can be improved by using the nested-PCR technique (XIANG et al, 2009), or the realtime PCR technique, which can also be used to detect different types of parasitic infections (BELL & RANFORD-CARTWRIGHT, 2002).…”

Section: Discussionmentioning

confidence: 99%

Molecular detection of protozoa of the Sarcocystidae family in sheep from the State of Rio Grande do Sul, Brazil

et al. 2016

View full text Add to dashboard Cite

Infections caused by protozoa belonging to the (17/80,.2) of the tested samples and T. gondii DNA in 15% (12/80,. Moreover, 6.2% (5/80,) samples contained DNA of both protozoan. The presence of N. caninum nucleic acids was not observed in tested samples. However, 21,2% (17/80, IC: 12,2) das amostras testadas e DNA de T. gondii em 15% (12/80, IC: 7,8). Em 6,2% (5/80, IC: 2,[1][2][3][4][5][6][7][8][9][10][11][12][13]9), foram detectados DNA de ambos os protozoários. Todas as amostras positivas no PCR (23, IC: 14,1)

show abstract

“…The patient was discharged after 7 days of oral treatment and remained asymptomatic for the next 3 months under our observation. At this time, during a pathologic review of the gallbladder in patients with AIDS, Sarcocystis infection was diagnosed, first in sections previously stained with hematoxylin and eosin and then confirmed by PCR of the residual paraffin-embedded biopsy tissue (MacLean et al 2007;Xiang et al 2009). DNA was Fig.…”

Section: Case Presentationmentioning

confidence: 99%

“…Lane 1, 100 bp molecular size markers; Lane 2, Cryptosporidium DNA sample; Lane 3, Isospora belli DNA sample; lane 4, study simple; lane 5, negative control extracted from parasites in excised tissue using the phenol/chloroform method as previously described (Yang ZQ et al 2001). Part of the 18S rDNA gene was amplified using a semi-nested PCR procedure, as previously reported (Xiang et al 2009). Briefly, the primary PCR used primers 18s 2L (GGATAAACCGTGGTAATTCTATG) and 18s 2H (ACCT-GTTATTGCCTCAAACTTC).…”

Section: Case Presentationmentioning

confidence: 99%

First detection of acalculous cholecystitis associated with Sarcocystis infection in a patient with AIDS

Agholi

Heidarian

Moghadami

et al. 2014

Acta Parasitologica

View full text Add to dashboard Cite

Acalculous cholecystitis and cholangitis are increasingly being recognized as complications of AIDS. The opportunistic parasites that have been most commonly associated with these disorders are Cryptosporidium species, Isospora belli, Cyclospora cayetanensis and Enterocytozoon bieneusi. The authors performed a parasitological survey on the gallbladder tissue sections of patients underwent cholecystectomy due to chronic acalculous cholecystitis at the Shiraz University of Medical Sciences, Iran. Light microscopic investigation in more than three hundred archived histopathological slides revealed the presence of sexual stages (i.e., mature sporocysts) of a coccidial protozoan in a patient with AIDS who developed acalculous cholecystitis as confirmed by histological, parasitological and molecular tests in which Sarcocystis species was the only identifiable pathogen in gallbladder sections. In the best of our knowledge it's the first documented case of chronic non-calculous cholecystitis due to Sarcocystis parasite in an Iranian AIDS patient from worldwide.

show abstract

Non-invasive methods for identifying oocysts of Sarcocystis spp. from definitive hosts

Cited by 33 publications

References 9 publications

Molecular Identification and Prevalence of Sarcocystis Suihominis in Pork Meat Intended for Public Consumption

Molecular Identification and Prevalence of Sarcocystis Suihominis in Pork Meat Intended for Public Consumption

Molecular detection of protozoa of the Sarcocystidae family in sheep from the State of Rio Grande do Sul, Brazil

First detection of acalculous cholecystitis associated with Sarcocystis infection in a patient with AIDS

Contact Info

Product

Resources

About