Nucleotide sequence of the intergenic spacer and the 18S ribosomal RNA gene from mustard<i>(Sinapis alba)</i>

Rathgeber, Jörg; Capesius, Ingrid

doi:10.1093/nar/18.5.1288

Cited by 35 publications

(20 citation statements)

References 2 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Such a divergence in a highly conserved region was rather unlikely. When the B. oleracea sequence is corrected all of these positions became identical to the published sequences for radish [5], mustard [13] and Eruca sativa (Lakshmikumaran, personal communication). Only two positions remain different in Arabidopsis which belongs to a different tribe [ 11 ].…”

Section: T G T C C T G C T a A G C A C G T [~T G T C T C C G G A C A mentioning

confidence: 69%

“…Ribosomal genes from three additional crucifers (Arabidopsis thaliana [ 11 ], Sinapis alba [ 13 ], and Brassica oleracea [2]) have recently been isolated and sequenced by different groups. Genes from other related species such as B. campestris, B. nigra and Eruca sativa are also currently investigated and should be available soon.…”

Section: Cc~cgtgctgatatgcgtact~acggacagtcctcgtgggcgaaaatcacccacgga~agmentioning

confidence: 99%

See 1 more Smart Citation

The Brassica oleracea rDNA spacer revisited

et al. 1992

View full text Add to dashboard Cite

The large intergenic ribosomal gene spacer is an important D N A sequence from at least two points of view. This is the region where most of the variability in the ribosomal genes resides [7,12,14] and detailed analysis of its sequence should unravel some of the molecular mechanisms leading to this extensive variability. A second important feature of the ribosomal gene spacer is that it contains the sites and information of transcription [5,9]. Because studies on both sequence evolution and promoter function rely on sequence information, it is of the utmost importance that the data are accurate and carefully checked. Sequencing a ribosomal spacer is somewhat more difficult than sequencing protein-coding genes for several reasons. The first is that the sequence does not code for a protein and cannot be compared with an independently determined protein or cDNA sequence, a possibility which is very often a useful safeguard in avoiding sequencing mistakes. A second difficulty is that all ribosomal spacer genes are made, at least in part, of repeated sequences. Since sequencing of long stretches of D N A most often involves an Exo III nuclease strategy, it is essential to control very Fig. 1. Analysis of the clone pBO11 on 0.7~o agarose gel. Lane A: Eco RI-Nsi I double digest of pBO 11 showing the linearized vector (V), and the three main rDNA fragments. Lane B: marker lane, showing a Hind I! digest of the plasmid pCa 8 (3). Lane C: marker lane, showing a 123 bp DNA ladder (BRL)The nucleotide sequence data reported will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession number X60324.

show abstract

Section: T G T C C T G C T a A G C A C G T [~T G T C T C C G G A C A mentioning

confidence: 69%

Section: Cc~cgtgctgatatgcgtact~acggacagtcctcgtgggcgaaaatcacccacgga~agmentioning

confidence: 99%

The Brassica oleracea rDNA spacer revisited

et al. 1992

View full text Add to dashboard Cite

show abstract

“…Similarly, this motif is present in the repeat elements of the IGS ofR. sativus [10], Arabidopsis thaliana [23], Sinapis alba [39] and B. campestris (M. Lakshmikumaran, unpublished results). Thus it is evident that this element of 8 bases may be an ancestral sequence, as it is conserved in the IGS of all the crucifers analysed so far.…”

Section: Sequence Analysis Of the 3 Kb And 4 Kb Variantsmentioning

confidence: 84%

“…Comparison of the putative promoter region of Eruca sativa with published IGS sequences, such as R. sativus [10], B. oleracea [4], Arabidopsis thaliana [23], wheat [3], rice [8] and S. alba [39] revealed the presence of conserved D N A sequences. It is known that the rDNA promoter spans a region from -160 to + 5 relative to the transcription initiation site at + 1 [42].…”

Section: Putative Promoter Regionmentioning

confidence: 95%

Structural analysis of two length variants of the rDNA intergenic spacer from Eruca sativa

Lakshmikumaran

Negi

1994

Plant Mol Biol

View full text Add to dashboard Cite

Restriction enzyme analysis of the rRNA genes of Eruca sativa indicated the presence of many length variants within a single plant and also between different cultivars which is unusual for most crucifers studied so far. Two length variants of the rDNA intergenic spacer (IGS) from a single individual E. sativa (cv. Itsa) plant were cloned and characterized. The complete nucleotide sequences of both the variants (3 kb and 4 kb) were determined. The intergenic spacer contains three families of tandemly repeated DNA sequences denoted as A, B and C. However, the long (4 kb) variant shows the presence of an additional repeat, denoted as D, which is a duplication of a 224 bp sequence just upstream of the putative transcription initiation site. Repeat units belonging to the three different families (A, B and C) were in the size range of 22 to 30 bp. Such short repeat elements are present in the IGS of most of the crucifers analysed so far. Sequence analysis of the variants (3 kb and 4 kb) revealed that the length heterogeneity of the spacer is located at three different regions and is due to the varying copy numbers of repeat units belonging to families A and B. Length variation of the spacer is also due to the presence of a large duplication (D repeats) in the 4 kb variant which is absent in the 3 kb variant. The putative transcription initiation site was identified by comparisons with the rDNA sequences from other plant species.

show abstract

“…Comparing species of different genera within a plant family considerable sequence divergency is observed, e.g., for radish (Raphanus sativus) , Sinapis alba and Arabidopsis thaliana (OelcassoTremousaygue et al 1988;Rathgeber and Capesius 1990;Gruendler et al 1991), Lycopersicon esculentum and Solanum tuberosum (Schmidt-Puchta et al 1989;Perry and Palukatis 1990;Borisjuk and Hemleben 1993), or Triticum aestivum and Zea mays (Toloczyki and Feix 1986;Barker et al 1988). Nearly no sequence similarity of the IGS (except for short motifs) among representatives of different plant families was found.…”

mentioning

confidence: 99%