Occurrence of mecA and blaZ genes in methicillin-resistant Staphylococcus aureus associated with vaginitis among pregnant women in Ado-Ekiti, Nigeria

Abstract

Methicillin-resistant Staphylococcus aureus (MRSA) is an increasingly prevalent pathogen. We studied the prevalence of MRSA and its association with vaginitis during pregnancy. Bacteriological investigations of high vaginal swabs of 350 healthy pregnant women attending antenatal clinics were carried out. Staphylococci were isolated from high vaginal swabs of 135 of the women. The staphylococcal isolates were resistant to multiple antibiotics. The PCR amplification of DNA of 20 selected isolates yielded six possessing the mecA gene and 13 the blaZ gene. MRSA possessing both the mecA and blaZ genes were isolated from subjects who reported vaginal discharge and itching.

Identification and Molecular Characterization of Antibiotics Resistance Staphylococcus species from of the Nasal Cavity of Goats in Adama, Ethiopia

“…It was realized that certain PSSIs had shown positive for nuc gene ampli cation. The sequence of primer designed that used for detection of nuc gene was previously reported [24]. As it was previously reported, nuc gene was considered as a genetic marker for identi cation of S. aureus using conventional PCR [92] which is a similar nding to our estimation.…”

“…Forward (blaZ-F: tacaactgtaatatcggaggg) and Reverse (blaZ-R: cattacactcttggcggtttc) primers used for ampli cation of blaZ gene for staphylococcus isolates was obtained from Okiki et al [24]. The blaZ ampli cation program was performed under the following conditions: Initial denaturation 95°C for 5min, 37 cycles of 95°C for 30s, 55°C for 30s, 72°C for one minute with a nal extension of 72°C for 10min.…”

“…A β-lactamase encoded blaZ gene has been isolated from Penicillin resistance in S. aureus using molecular technique. It has been con rmed that there is plasmid mediated gene which is similar to mecA gene that chromosome-mediated in S. aureus [24]. The S. aureus produces thermo-nuclease enzyme which encoded by nuc gene which is a calcium dependent enzyme that catalyse the hydrolysis of both DNA and RNA at 5' position of the phosphodiester bond yielding 3'-mononucleotides and dinucleotides [25].…”

The Potential Threat of Vertical Transmission in Methicillin-Resistant Staphylococcus Aureus Infection: A Systematic Review 2022

“…An observational study conducted in Nigeria in 2020 studied 350 apparently healthy mothers between the ages of 19-43 years attending their antenatal clinic [ 16 ]. One hundred and thirty-five women from this study population were swabbed for high vaginal swabs and showed various forms of staphylococcus of which 56.1% of the samples were MSSA .…”

Assessing the prevalence and antibiotic susceptibility patterns of S. aureus bacteria isolated from Iraqi women with vaginosis

“…It has been shown that Lactobacilli has a role in preventing infections, by its ability to maintain vaginal acidic conditions (PH) and ensure the presence of hydrogen peroxide in the vaginal environment. Furthermore, a recent study on BV pathogenesis reported that Lactobacilli can form a biofilm on the epithelium cells of the vagina that serves as a "scaffold" to which many other bacterial species can adhere in a symbiotic manner and then colonize the vaginal cavity [3]. On the other hand, polymicrobial infection is caused by a decrease in lactobacilli and an increase in pathogenic bacteria, primarily anaerobic or microaerophilic species including Gardnerella spp, Mobiluncus spp, Bacteroide spp, Prevotella species, and Mycoplasma spp.…”