OPTIMIZATION OF PCRs

Innis, Michael A.; Gelfand, David H.

doi:10.1016/b978-0-12-372180-8.50005-6

Cited by 670 publications

(525 citation statements)

References 10 publications

Supporting

Mentioning

516

Contrasting

Unclassified

Order By: Relevance

“…All of the selected phylogenetic marker sequences were successfully used for phylogenetic reconstruction in previous studies (White et al . 1990; Taberlet et al . 1991; Mummenhoff et al .…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Divergence of annual and perennial species in the Brassicaceae and the contribution of cis‐acting variation at FLC orthologues

Kiefer

Severing

Karl³

et al. 2017

Molecular Ecology

View full text Add to dashboard Cite

Variation in life history contributes to reproductive success in different environments. Divergence of annual and perennial angiosperm species is an extreme example that has occurred frequently. Perennials survive for several years and restrict the duration of reproduction by cycling between vegetative growth and flowering, whereas annuals live for 1 year and flower once. We used the tribe Arabideae (Brassicaceae) to study the divergence of seasonal flowering behaviour among annual and perennial species. In perennial Brassicaceae, orthologues of FLOWERING LOCUS C (FLC), a floral inhibitor in Arabidopsis thaliana, are repressed by winter cold and reactivated in spring conferring seasonal flowering patterns, whereas in annuals, they are stably repressed by cold. We isolated FLC orthologues from three annual and two perennial Arabis species and found that the duplicated structure of the A. alpina locus is not required for perenniality. The expression patterns of the genes differed between annuals and perennials, as observed among Arabidopsis species, suggesting a broad relevance of these patterns within the Brassicaceae. Also analysis of plants derived from an interspecies cross of A. alpina and annual A. montbretiana demonstrated that cis‐regulatory changes in FLC orthologues contribute to their different transcriptional patterns. Sequence comparisons of FLC orthologues from annuals and perennials in the tribes Arabideae and Camelineae identified two regulatory regions in the first intron whose sequence variation correlates with divergence of the annual and perennial expression patterns. Thus, we propose that related cis‐acting changes in FLC orthologues occur independently in different tribes of the Brassicaceae during life history evolution.

show abstract

“…All of the selected phylogenetic marker sequences were successfully used for phylogenetic reconstruction in previous studies (White et al . 1990; Taberlet et al . 1991; Mummenhoff et al .…”

Section: Methodsmentioning

confidence: 99%

“…Primer sequences, including the ones for the amplification of ITS (White et al . 1990; Mummenhoff et al . 1997), trnL (Taberlet et al .…”

Section: Methodsmentioning

confidence: 99%

Divergence of annual and perennial species in the Brassicaceae and the contribution of cis‐acting variation at FLC orthologues

Kiefer

Severing

Karl³

et al. 2017

Molecular Ecology

View full text Add to dashboard Cite

show abstract

“…DNA was quantified in the extracts by fluorometry (QuBit 3.0, Thermo Fisher Scientific, USA), with individual extracts ranging from 4.32 to 24.6 ng total DNA. The second internal transcribed spacer (ITS2) region of ribosomal DNA was amplified by polymerase chain reaction (PCR) using the fungi‐specific gITS7 forward primer (Ihrmark et al., 2012) and the general eukaryote ITS4 reverse primer (White, Bruns, Lee, & Taylor, 1990). The gITS7 primer included unique indexed tags for each sample to allow for multiplex sequencing.…”

Section: Methodsmentioning

confidence: 99%

Complex effects of mammalian grazing on extramatrical mycelial biomass in the Scandes forest‐tundra ecotone

Vowles

Lindwall

Ekblad

et al. 2017

Ecology and Evolution

View full text Add to dashboard Cite

Mycorrhizal associations are widespread in high‐latitude ecosystems and are potentially of great importance for global carbon dynamics. Although large herbivores play a key part in shaping subarctic plant communities, their impact on mycorrhizal dynamics is largely unknown. We measured extramatrical mycelial (EMM) biomass during one growing season in 16‐year‐old herbivore exclosures and unenclosed control plots (ambient), at three mountain birch forests and two shrub heath sites, in the Scandes forest‐tundra ecotone. We also used high‐throughput amplicon sequencing for taxonomic identification to investigate differences in fungal species composition. At the birch forest sites, EMM biomass was significantly higher in exclosures (1.36 ± 0.43 g C/m2) than in ambient conditions (0.66 ± 0.17 g C/m2) and was positively influenced by soil thawing degree‐days. At the shrub heath sites, there was no significant effect on EMM biomass (exclosures: 0.72 ± 0.09 g C/m2; ambient plots: 1.43 ± 0.94). However, EMM biomass was negatively related to Betula nana abundance, which was greater in exclosures, suggesting that grazing affected EMM biomass positively. We found no significant treatment effects on fungal diversity but the most abundant ectomycorrhizal lineage/cortinarius, showed a near‐significant positive effect of herbivore exclusion (p = .08), indicating that herbivory also affects fungal community composition. These results suggest that herbivory can influence fungal biomass in highly context‐dependent ways in subarctic ecosystems. Considering the importance of root‐associated fungi for ecosystem carbon balance, these findings could have far‐reaching implications.

show abstract

“…The nuclear ribosomal ITS region (including ITS1, 5.8S rRNA,and ITS2), an approximately 600‐base‐pair region frequently used in species‐level systematics for fungi, was chosen as the target gene because it has been proposed as the standard barcode for fungi and has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter‐ and intraspecific variations (Schoch et al., 2012). The ITS gene was amplified by polymerase chain reactions (PCRs) using the fungal primer set of ITS1 (5′‐ NNNNNNNNNN TCCGTAGGTGAACCTGCGG‐3′) and ITS4 (5′‐TCCTCCGCTTATTGATATGC‐3′) (White, Bruns, Lee, & Taylor, 1990), where NNNNNNNNNN represents the 10‐bp barcode designed for sample identification and the ITS primers were fused with the 454 pyrosequencing adapters. The PCRs were carried out in a 20‐μl reaction mixture containing 4 μl 5× FastPfu Buffer, 0.4 μl FastPfu polymerase, 2 μl 2.5 mmol/L dNTP mix (all from Beijing TransGen Biotech Co., Ltd., Beijing, China), 0.8 μl 5 μmol/L of each primer, and 10 ng of template DNA.…”

Section: Methodsmentioning

confidence: 99%

Phylogenetic congruence between subtropical trees and their associated fungi

Liu

Liang

Etienne

et al. 2016

Ecology and Evolution

View full text Add to dashboard Cite

Recent studies have detected phylogenetic signals in pathogen–host networks for both soil‐borne and leaf‐infecting fungi, suggesting that pathogenic fungi may track or coevolve with their preferred hosts. However, a phylogenetically concordant relationship between multiple hosts and multiple fungi in has rarely been investigated. Using next‐generation high‐throughput DNA sequencing techniques, we analyzed fungal taxa associated with diseased leaves, rotten seeds, and infected seedlings of subtropical trees. We compared the topologies of the phylogenetic trees of the soil and foliar fungi based on the internal transcribed spacer (ITS) region with the phylogeny of host tree species based on matK, rbcL, atpB, and 5.8S genes. We identified 37 foliar and 103 soil pathogenic fungi belonging to the Ascomycota and Basidiomycota phyla and detected significantly nonrandom host–fungus combinations, which clustered on both the fungus phylogeny and the host phylogeny. The explicit evidence of congruent phylogenies between tree hosts and their potential fungal pathogens suggests either diffuse coevolution among the plant–fungal interaction networks or that the distribution of fungal species tracked spatially associated hosts with phylogenetically conserved traits and habitat preferences. Phylogenetic conservatism in plant–fungal interactions within a local community promotes host and parasite specificity, which is integral to the important role of fungi in promoting species coexistence and maintaining biodiversity of forest communities.

show abstract

OPTIMIZATION OF PCRs

Cited by 670 publications

References 10 publications

Divergence of annual and perennial species in the Brassicaceae and the contribution of cis‐acting variation at FLC orthologues

Divergence of annual and perennial species in the Brassicaceae and the contribution of cis‐acting variation at FLC orthologues

Complex effects of mammalian grazing on extramatrical mycelial biomass in the Scandes forest‐tundra ecotone

Phylogenetic congruence between subtropical trees and their associated fungi

Contact Info

Product

Resources

About