Optimized Conditions for Cloning PCR Products Into an
            <i>Xcm</i>
             I T-Vector

Schutte, Brian C.; Ranade, Koustubh; Pruessner, Jonathan A.; Dracopoli, Nicholas C.

doi:10.2144/97221bm06

Cited by 30 publications

(14 citation statements)

References 1 publication

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Reverse transcriptase-generated cDNA encoding for the AUFL element of the c-fos 3Ј-UTR was amplified using the primers CATGCATTGTTGAGGTGGTC (sense) and CTTGGAACAATAAGCAA-ACAATG (antisense), giving a 201-bp product corresponding to the positions 3301-3501 in the c-fos mRNA sequence. The amplified cDNA fragments were cloned into the XcmI site of pXcmI (28) to give the clones pCR-non-AU, pCR-AU, pCR-A, pCR-B, pCR-C, and pCR-AUFLc-fos. DNA sequences of all of the clones were determined by sequencing.…”

Section: Methodsmentioning

confidence: 99%

Complex Contribution of the 3′-Untranslated Region to the Expressional Regulation of the Human Inducible Nitric-oxide Synthase Gene

Rodrı́guez-Pascual¹,

Hausding²,

Ihrig-Biedert³

et al. 2000

Journal of Biological Chemistry

165

180

View full text Add to dashboard Cite

Section: Methodsmentioning

confidence: 99%

Complex Contribution of the 3′-Untranslated Region to the Expressional Regulation of the Human Inducible Nitric-oxide Synthase Gene

Rodrı́guez-Pascual¹,

Hausding²,

Ihrig-Biedert³

et al. 2000

Journal of Biological Chemistry

165

180

View full text Add to dashboard Cite

“…Probes for chick Wnt8c, Fgf10 and Fgf8 were kindly provided by Drs Jane Dodd, Sumihare Noji and Juan Carlos Izpisua Belmonte (Hume and Dodd, 1993;Vogel et al, 1996;Ohuchi et al, 1997). Chick Pea3 was amplified by RT-PCR utilizing the published sequence, then subcloned into the pKRX vector (Schutte et al, 1997). The DNA fragment encoding the Env gene was isolated from the RCASBP retrovirus vector (Mogan and Fekete, 1996), and then subcloned into pBluescript SKII(+) vector.…”

Section: Whole-mount In Situ Hybridization and Probe Isolationmentioning

confidence: 99%

Tbx5 and Tbx4 trigger limb initiation through activation of the Wnt/Fgf signaling cascade

et al. 2003

View full text Add to dashboard Cite

A tight loop between members of the fibroblast growth factor and the Wnt families plays a key role in the initiation of vertebrate limb development. We show for the first time that Tbx5 and Tbx4 are directly involved in this process. When dominant-negative forms of these Tbx genes were misexpressed in the chick prospective limb fields, a limbless phenotype arose with repression of both Wnt and Fgf genes By contrast, when Tbx5 and Tbx4 were misexpressed in the flank, an additional wing-like and an additional leg-like limbs were induced, respectively. This additional limb formation was accompanied by the induction of both Wnt and Fgf genes These results highlight the pivotal roles of Tbx5 and Tbx4 during limb initiation, specification of forelimb/hindlimb and evolution of tetrapod limbs, placing Tbx genes at the center of a highly conserved genetic program.

show abstract

“…The PCR reaction was performed using 1ng of template DNA, 1 mM of each PCR primer, 0.25 U of Taq DNA polymerase (Boehringer Mannheim, Indianapolis, IN) and the recommended buffer in a total volume of 100 ml. The thermal cycling parameters were an initial denaturation step at 94 C for 2 minutes then 35 cycles at 94 C for 0.5 min, 55 C for 0.5 min, 72 C for 0.5 min and finally 5 minutes at 72 C. A 390 bp product was amplified with these primers and cloned into the XcmI T-cloning vector pKRX (25). The resulting clone was called pH19-17 (397 bp).…”

Section: Rna Isolation From Fetal Sheep Tissuesmentioning

confidence: 99%

Ontogeny of the H19 Gene in Sheep and Effect of Maternal Fasting on Its Expression in the Fetus

et al. 2001

Self Cite

View full text Add to dashboard Cite

Mapped on the same chromosome as the Insulin-like Growth Factor II (IGF-II), an important factor regulating fetal growth, the H19 gene, is believed to play a role during embryogenesis and to share similar regulatory elements with IGF-II possibly by an enhancer competition system. This study was designed to characterize the ontogeny of H19 in sheep and the effect of maternal fasting on the expression of fetal IGF-II and H19 mRNA. A partial cDNA clone for the ovine H19 gene was isolated and used as a probe for RNase protection analysis. The ontogeny of H19 in liver, skeletal muscle and heart of ovine fetuses at 62,100 and 130 days, lambs at 1 month and adult sheep revealed high tissue levels of H19 mRNA during fetal life that decreased significantly after birth. Maternal fasting significantly decreased fetal liver H19 mRNA expression but did not alter fetal IGF-II mRNA expression. These results suggest that H19, like IGF-II, may play an important role in the regulation of fetal growth and define an environmental condition whereby these two genes are regulated independently.

show abstract

Optimized Conditions for Cloning PCR Products Into an Xcm I T-Vector

Cited by 30 publications

References 1 publication

Complex Contribution of the 3′-Untranslated Region to the Expressional Regulation of the Human Inducible Nitric-oxide Synthase Gene

Complex Contribution of the 3′-Untranslated Region to the Expressional Regulation of the Human Inducible Nitric-oxide Synthase Gene

Tbx5 and Tbx4 trigger limb initiation through activation of the Wnt/Fgf signaling cascade

Ontogeny of the H19 Gene in Sheep and Effect of Maternal Fasting on Its Expression in the Fetus

Contact Info

Product

Resources

About