Ovine and Caprine Brucellosis (<i>Brucella melitensis</i>) in Aborted Animals in Jordanian Sheep and Goat Flocks

Samadi, Assadullah; Ababneh, Mustafa; Giadinis, Nektarios D.; Lafi, Shawkat Q.

doi:10.4061/2010/458695

Cited by 44 publications

(42 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Like caprine brucellosis, the zoonotic form of ovine brucellosis is caused by Brucella melitensis (Garin-Bastuji, 1994;Samadi et al, 2010;Montasser et al, 2011) and characterized by abortion, stillbirth and placentitis in ewes . This Brucella spp.…”

Section: Advances In Animal and Veterinary Sciencesmentioning

confidence: 99%

Seroprevalence of Brucellosis in Sheep and Humans in District Kohat, Pakistan

Hussain¹,

Rind²,

Adil

et al. 2014

Adv. Anim. Vet. Sci.

View full text Add to dashboard Cite

| Brucellosis is a bacterial disease and is caused by genus Brucella. It is highly prevalent zoonotic disease in developing countries including Pakistan. This study was conducted to determine the prevalence of brucellosis in sheep and humans of district Kohat, Khyber Pakhtunkhwa. For this purpose, one hundred blood samples from each humans and sheep (50 each from both sexes) were randomly collected at three different tehsils (Lachi, Seni Gumbat and Kohat) of district Kohat. The serum samples were tested for presence of anti-Brucella antibodies by Rose Bengal Plate Test (RBPT) and Serum Agglutination Test (SAT). Moreover, a total of 50 milk samples were also collected from various sheep herds for subsequent conduction of milk ring test (MRT). The estimated prevalence of ovine brucellosis was 12.12%, 09% and 08.82% in Lachi, Seni Gumbat and Kohat, respectively, with an overall prevalence of 10% in the district. Whereas, SAT and RBPT demonstrated the prevalence as 7% and 6%, respectively, in humans. The results of current study validated that brucellosis was widespread in district Kohat with a relatively higher prevalence being recorded in ewes and occupationally exposed women than their male counterparts. Furthermore, the prevalence of brucellosis was significantly higher in sheep and humans of Lachi and Seni Gumbat tehsils as compared to Kohat. Results of the current study may support the health care organizers to formulate suitable control plans against Brucellosis.

show abstract

Section: Advances In Animal and Veterinary Sciencesmentioning

confidence: 99%

Seroprevalence of Brucellosis in Sheep and Humans in District Kohat, Pakistan

Hussain¹,

Rind²,

Adil

et al. 2014

Adv. Anim. Vet. Sci.

View full text Add to dashboard Cite

show abstract

“…Os agentes normalmente descritos neste tocante são a Brucella sp. (Samadi et al, 2010;Wareth et al, 2015), Chlamydophila sp. (Pereira et al, 2009;Hazlett et al, 2013), Leptospira sp.…”

Section: Introductionunclassified

Fatores de risco na transmissão e soroprevalência da infecção de Chlamydophila abortus a ovinos e caprinos

Leopoldo

Pinheiro

Alves

et al. 2016

Pesq. agropec. bras.

View full text Add to dashboard Cite

Resumo -O objetivo deste trabalho foi avaliar os fatores de risco envolvidos na transmissão de Chlamydophila abortus a ovinos e caprinos, bem como verificar a soroprevalência da infecção. Foram selecionadas 110 propriedades, com um total de 500 amostras de ovinos -350 da Microrregião do Alto Médio Gurgueia (MRAMG) e 150 da Microrregião Homogênea de Teresina (MRHT), ambas do Estado do Piauí -e 600 amostras de caprinos -300 da MRAMG e 300 da MRHT. Um questionário epidemiológico foi empregado para identificar os principais fatores de risco. Os anticorpos anti-C. abortus foram detectados pela técnica de fixação de complemento. A prevalência geral da infecção por C. abortus foi de 7,2% (79/1.100). A prevalência em caprinos e ovinos na MRAMG foi de 7,9% (51/650) e, na MRHT, foi de 6,2% (28/450). Nas microrregiões estudadas, a prevalência em ovinos foi de 8,2% (41/500) e, em caprinos, de 6,3% (38/600). O sistema de criação, as práticas reprodutivas e o tipo racial foram fatores de risco relevantes para a infecção em ovinos. Também foram relevantes em caprinos as práticas reprodutivas e a origem das matrizes e dos reprodutores. A raça Dorper apresenta maior suscetibilidade à infecção por C. abortus.Termos para indexação: Capra aegagrus hircus, Ovis aries, clamidofilose, epidemiologia, manejo reprodutivo, pequenos ruminantes. Risk factors in the transmission and seroprevalence of Chlamydophila abortus infection in sheep and goatsAbstract -The objective of this work was to evaluate the risk factors involved in the transmission of Chlamydophila abortus to sheep and goats, as well as to verify the seroprevalence of the infection. One hundred ten farms were selected, with a total of 500 sheep samples -350 from the Microregion of Alto Médio Gurgueia (MRAMG), and 150 from the Homogeneous Microregion of Teresina (MRHT), both in the state of Piauí, Brazil -and 600 goat samples -300 of the MRAMG and 300 of the MRHT. An epidemiological questionnaire was used to identify the main risk factors. Anti-C. abortus antibodies were detected by the complement fixation technique. Overall prevalence of infection by C. abortus was 7.2% (79/1,100). The prevalence in goats and sheep in the MRAMG was 7.9% (51/650), and in the MRHT it was 6.2% (28/450). In the studied microregions, the prevalence in sheep was 8.2% (41/500), and in goats it was 6.3% (38/600). The raising system, reproductive practices, and racial type were significant risk factors for infection in sheep. Also significant in goats were the reproductive practices and the origin of the does and bucks. The Dorper breed shows increased susceptibility to infection with C. abortus.

show abstract

“…These figures are lower than those 247 previously reported, in which Brucella was detected in 20.86%, 31% and 34.56% of aborted sheep 248 fetuses in Iran, Turkey and Greece, respectively. Of course, our finding is in accordance with 249 these findings who reported B. melitensis strain as a dominant strain in the sheep fetuses 250 (Dehkordi et al 2012;Leyla et al 2003;Samadi et al 2010). Also, E. coli was found in 3 sheep 251 fetuses.…”

supporting

confidence: 82%

Untitled

Supplemental Information 1: Raw Data

View full text Add to dashboard Cite

In the farming industry, the productivity of livestock herds depends on the fertility efficiency of animals. The accurate diagnosis of a broad range of aetiological agents causing fetal death is often difficult. Our aim was to assess the prevalence rates of Toxoplasma gondii, Neospora caninum, and Brucella spp. infections in ruminant abortion using bacteriological culture and molecular techniques in Mazandaran Province, northern Iran. Samples were collected from 70 aborted sheep, goat, and cattle fetuses between September 2014 and December 2015. Necropsy was performed on all the received samples, and brain tissue and abomasal content were obtained from the aborted fetuses.Protozoan infections were detected by specific polymerase chain reaction (PCR) and bacterial agents using bacteriological examinations and PCR assay.Infectious pathogens were detected in 22 out of 70 (31.4%) examined fetuses. Moreover, T. gondii, N. caninum, and B. melitensis were verified in 13 (18.6%), 4 (5.7%), and 2 (2.85%) samples, respectively. Our results showed that infection with the mentioned pathogenic agents brings about considerable fetal mortality, which can be a major cause of economic loss.The listed pathogens could be considered important etiological agents of fetal loss in Mazandaran Province, for which appropriate control measures such as vaccination and biosecurity can be implemented to prevent infection and reduce reproductive loss in livestock farms. . These parasites belong to the phylum Apicomplexa which are (Bretagne et al. 1993;Yamage et al. 1996). 81Brucella is the most important abortifacient bacterial agent with great economic importance in 82 livestock in many areas of the world. Brucellosis is still a widespread zoonotic disease and some 83 of the species of genus Brucella are pathogenic for human (Leyla et al. 2003 170 TGCCGATCACTTAAGGGCCTTCAT) (18). The PCR amplification was carried out on 1 µl of 171 genomic DNA (prepared freshly by boiling method as described above) with the following steps:172 95 0 C for 5 min as initial denaturation followed by 35 cycles at 95 0 C for 75 sec as denaturation, 177 abortus strain 544 DNA (positive controls) were also included in each reaction. Electrophoresis179 Five microliters of the PCR products were run by electrophoresis through a 1% agarose gel 180 (BioNeer, Korea) stained with Safe stain (0.5 μg/ml-Cina Gen Co, Iran) and visualized using a 181 transilluminator (UVITEC). Statistical analysis183 Statistical analyses were estimated using the chi-square test and were performed with SPSS 184 version 14.0 software (SPSS, Chicago, Illinois). RESULTS186 Findings of our study are summarized in Table 1. A total of 70 samples were collected from 187 animals associated with aborted fetuses from fourteen counties in Mazandaran providence. The 188 great majority of abortions were during the last months of gestation. There were 57 sheep, 4 goats 189 and 9 cattle. 190Protozoal infections were detected by specific PCR in 17 out of 70 (24.3%) examined fetuses 191 ( Fig. 1 and Fig. 2...

show abstract

Ovine and Caprine Brucellosis (Brucella melitensis) in Aborted Animals in Jordanian Sheep and Goat Flocks

Cited by 44 publications

References 19 publications

Seroprevalence of Brucellosis in Sheep and Humans in District Kohat, Pakistan

Seroprevalence of Brucellosis in Sheep and Humans in District Kohat, Pakistan

Fatores de risco na transmissão e soroprevalência da infecção de Chlamydophila abortus a ovinos e caprinos

Untitled

Contact Info

Product

Resources

About