P-TEFb-Mediated Phosphorylation of hSpt5 C-Terminal Repeats Is Critical for Processive Transcription Elongation

Yamada, Tomoko; Yamaguchi, Yuki; Inukai, Naoto; Okamoto, Sachiko; Mura, Takashi; Handa, Hiroshi

doi:10.1016/j.molcel.2005.11.024

Cited by 342 publications

(361 citation statements)

References 54 publications

Supporting

Mentioning

348

Contrasting

Unclassified

Order By: Relevance

“…P-TEFb phosphorylates the Pol II CTD at Ser 2, which facilitates Pol II elongation and provides a binding platform for elongation and 3Ј-processing factors (Peterlin and Price 2006 and references therein). In addition, P-TEFb can phosphorylate both Spt5 and NELF; this has been suggested to trigger de-repression by releasing NELF from the elongation complex and converting Spt5 from a negative to a positive elongation factor (Fujinaga et al 1998;Ivanov et al 2000;Kim and Sharp 2001;Lavoie et al 2001;Yamada et al 2006). In agreement with a role for P-TEFb in releasing stalled Pol II, artificial recruitment of P-TEFb to the Hsp70 promoter under uninduced conditions led to an increase in basal transcription levels .…”

mentioning

confidence: 84%

NELF-mediated stalling of Pol II can enhance gene expression by blocking promoter-proximal nucleosome assembly

Gilchrist¹,

Nechaev²,

Lee³

et al. 2008

Genes Dev.

282

298

View full text Add to dashboard Cite

The Negative Elongation Factor (NELF) is a transcription regulatory complex that induces stalling of RNA polymerase II (Pol II) during early transcription elongation and represses expression of several genes studied to date, including Drosophila Hsp70, mammalian proto-oncogene junB, and HIV RNA. To determine the full spectrum of NELF target genes in Drosophila, we performed a microarray analysis of S2 cells depleted of NELF and discovered that NELF RNAi affects many rapidly inducible genes involved in cellular responses to stimuli. Surprisingly, only one-third of NELF target genes were, like Hsp70, up-regulated by NELF-depletion, whereas the majority of target genes showed decreased expression levels upon NELF RNAi. Our data reveal that the presence of stalled Pol II at this latter group of genes enhances gene expression by maintaining a permissive chromatin architecture around the promoter-proximal region, and that loss of Pol II stalling at these promoters is accompanied by a significant increase in nucleosome occupancy and a decrease in histone H3 Lys 4 trimethylation. These findings identify a novel, positive role for stalled Pol II in regulating gene expression and suggest that there is a dynamic interplay between stalled Pol II and chromatin structure.[Keywords: Gene expression; transcription elongation; polymerase stalling; chromatin structure] Supplemental material is available at http://www.genesdev.org.

show abstract

mentioning

confidence: 84%

NELF-mediated stalling of Pol II can enhance gene expression by blocking promoter-proximal nucleosome assembly

Gilchrist¹,

Nechaev²,

Lee³

et al. 2008

Genes Dev.

282

298

View full text Add to dashboard Cite

show abstract

“…In mammalian cells, the Spt4-Spt5 complex, which is also called DRB sensitivity inducing factor, and represses transcription elongation at the early elongation-recessive elongation transition (34,35). Phosphorylation of the C-terminal repeat region of Spt5 plays a key role in converting the complex from a repressor to a positive regulator of transcription (36,37 …”

Section: Nucleotide Excision Repair (Ner)mentioning

confidence: 99%

“…In human cells, Spt5 can be phosphorylated by positive transcription elongation factor b (P-TEFb), which is composed of Ctk9 and a cyclin subunit (34,36). In yeast, two cyclin-dependent kinases are homologous to human Ctk9 (55,56).…”

Section: Phosphorylation Of the Spt5 Ctr Domain By Bur Kinase Plays Amentioning

confidence: 99%

The C-terminal Repeat Domain of Spt5 Plays an Important Role in Suppression of Rad26-independent Transcription Coupled Repair

Ding

LeJeune

2010

Journal of Biological Chemistry

View full text Add to dashboard Cite

In eukaryotic cells, transcription coupled nucleotide excision repair (TCR) is believed to be initiated by RNA polymerase II (Pol II) stalled at a lesion in the transcribed strand of a gene. Rad26, the yeast homolog of the human Cockayne syndrome group B (CSB) protein, plays an important role in TCR. Spt4, a transcription elongation factor that forms a complex with Spt5, has been shown to suppress TCR in rad26⌬ cells. Here we present evidence that Spt4 indirectly suppresses Rad26-independent TCR by protecting Spt5 from degradation and stabilizing the interaction of Spt5 with Pol II. We further found that the C-terminal repeat (CTR) domain of Spt5, which is dispensable for cell viability and is not involved in interactions with Spt4 and Pol II, plays an important role in the suppression. The Spt5 CTR is phosphorylated by the Bur kinase. Inactivation of the Bur kinase partially alleviates TCR in rad26⌬ cells. We propose that the Spt5 CTR suppresses Rad26-independent TCR by serving as a platform for assembly of a multiple protein suppressor complex that is associated with Pol II. Phosphorylation of the Spt5 CTR by the Bur kinase may facilitate the assembly of the suppressor complex. Nucleotide excision repair (NER)2 is a conserved DNA repair mechanism capable of removing a variety of helix-distorting lesions, such as UV-induced cyclobutane pyrimidine dimers (CPDs) (1). NER can be grouped into two pathways: global genomic repair (GGR), which refers to repair throughout the genome, and transcription coupled repair (TCR), which refers to a repair mechanism that is dedicated to the transcribed strand of actively transcribed genes (2). In the yeast Saccharomyces cerevisiae, Rad7, Rad16 (3), and Elc1 (4) are specifically required for GGR, but dispensable for TCR. Rad7 and Rad16 form a complex that binds specifically to UV-damaged DNA in an ATP-dependent manner and has DNA-dependent ATPase activity (5). Elc1 has been shown to be a component of a ubiquitin ligase that contains Rad7 and Rad16, and is responsible for regulating the levels of Rad4 protein in response to UV damage (6, 7). It has also been suggested that Elc1 is a component of another ubiquitin ligase complex, which contains Ela1, Cul3, and Roc1 but not Rad7 and Rad16 (8,9). The role of Elc1 in GGR may not be subsidiary to that of Rad7 and Rad16 (4).The mechanistic details of TCR are relatively well understood in Escherichia coli. The transcription repair coupling factor Mfd targets the transcribed strand for repair by recognizing a stalled RNA polymerase and actively recruiting the NER machinery to the transcription blocking lesion as it dissociates the stalled RNA polymerase (10). Conversely, the TCR mechanisms in eukaryotes appear to be extremely complicated (for reviews, see Refs. 11 and 12). In mammalian cells, Cockayne syndrome group A (CSA) and B (CSB) proteins are specifically required for TCR, but dispensable for GGR (13-16). Like its human homolog CSB, the yeast Rad26 plays an important role in TCR but is dispensable for GGR (17). Both human CSB (18) ...

show abstract

“…The TRP-185 cDNA, modified to express a C-terminal His or Flag tag, was cloned into pFastBac1 or pcDNA3.1(ϩ) (Invitrogen), respectively, thus generating pFASTTRP-185-His and pcTRP-185-Flag. For the expression of a short hairpin RNA (shRNA) that targeted nucleotides 1414 to 1434 of the TRP-185 mRNA, the oligonucleotides 5Ј-ACTCAG TATATAGCGGAAAGTTCAAGAGACTTTCCGCTATACTGAGTCTTTT T-3Ј and 5Ј-GATCAAAAAGACTCAGTATAGCGGAAAGTCTCTTGAACT TTCCGCTATACTGAGTCA-3Ј were annealed and inserted into pBS-U6 (35), which contains the mouse U6 promoter. Next, a DNA fragment containing theAAGTTGAG-3Ј for a chromosome 2q34 region.…”

Section: Methodsmentioning

confidence: 99%

Adeno-Associated Virus Site-Specific Integration Is Regulated by TRP-185

Yamamoto

Suzuki

Kawano

et al. 2007

J Virol

Self Cite

View full text Add to dashboard Cite

Adeno-associated virus (AAV) integrates site specifically into the AAVS1 locus on human chromosome 19. Although recruitment of the AAV nonstructural protein Rep78/68 to the Rep binding site (RBS) on AAVS1 is thought to be an essential step, the mechanism of the site-specific integration, particularly, how the site of integration is determined, remains largely unknown. Here we describe the identification and characterization of a new cellular regulator of AAV site-specific integration. TAR RNA loop binding protein 185 (TRP-185), previously reported to associate with human immunodeficiency virus type 1 TAR RNA, binds to AAVS1 DNA. Our data suggest that TRP-185 suppresses AAV integration at the AAVS1 RBS and enhances AAV integration into a region downstream of the RBS. TRP-185 bound to Rep68 directly, changing the Rep68 DNA binding property and stimulating Rep68 helicase activity. We present a model in which TRP-185 changes the specificity of the AAV integration site from the RBS to a downstream region by acting as a molecular chaperone that promotes Rep68 complex formation competent for 3 35 DNA helicase activity.Adeno-associated virus (AAV) is a nonpathogenic human parvovirus that contains a linear single-stranded DNA genome of approximately 4.7 kb, carrying palindromic inverted terminal repeats (ITRs) at both ends that serve as the viral origin of replication. The AAV genome consists of two major open reading frames, rep and cap. The cap gene encodes three structural proteins, VP1, VP2, and VP3. The rep gene encodes four nonstructural proteins, Rep78, Rep68, Rep52, and Rep40. The nonstructural proteins have multiple activities, such as DNA binding, ATPase, helicase, and endonuclease activities, and play pivotal roles in various stages of the viral life cycle, including integration, replication, and regulation of viral gene expression. For efficient AAV replication and gene expression, coinfection by a helper virus, such as adenovirus or herpesvirus, is required. In the absence of a helper virus, AAV infection results in stable integration of the viral DNA genome into a specific locus on chromosome 19, called AAVS1 (17,25). This property of AAV is unique among eukaryotic DNA viruses.In the current model of AAV site-specific integration, following infection, the single-stranded AAV genome is converted to duplex DNA. Next, the viral p5 promoter is activated and directs the synthesis of Rep78 and Rep68. These proteins bind to the 16-bp Rep binding site (RBS) present in the AAV ITRs and the p5 promoter. Rep78/68 also binds to an RBS in the AAVS1 region of chromosome 19 and recruits the AAV genome to AAVS1 (8, 31). Rep78/68 then creates a nick at the 6-bp terminal resolution site (trs) flanking the RBS on AAVS1, and its helicase activity unwinds the duplex trs in the 3Ј35Ј direction to facilitate DNA replication (8,29). Subsequently, the AAV genome is integrated into the AAVS1 site within ca. 1 kb downstream of the RBS (8, 21). Currently, there are two models of the formation of the AAV-AAVS1 junction. One model assum...

show abstract

P-TEFb-Mediated Phosphorylation of hSpt5 C-Terminal Repeats Is Critical for Processive Transcription Elongation

Cited by 342 publications

References 54 publications

NELF-mediated stalling of Pol II can enhance gene expression by blocking promoter-proximal nucleosome assembly

NELF-mediated stalling of Pol II can enhance gene expression by blocking promoter-proximal nucleosome assembly

The C-terminal Repeat Domain of Spt5 Plays an Important Role in Suppression of Rad26-independent Transcription Coupled Repair

Adeno-Associated Virus Site-Specific Integration Is Regulated by TRP-185

Contact Info

Product

Resources

About