PCR

McPherson, M.J.; Møller, Simon Geir

doi:10.4324/9780203002674

Cited by 48 publications

(30 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…However, 70% primer–template sequence identity can be sufficient for successful annealing and amplification from pure cultures, and in this study weak amplification of DNA from pure cultures occurred with ≤ 4 primer–template mismatches (Table 2; discussed below). Thus, our in silico analyses with OligoCheck were based on two main assumptions: (i) three primer mismatches would still result in PCR product formation, and (ii) a perfect 3 bp primer–template at the primer 3′ end would be required for amplification (McPherson and Moller, 2000).…”

Section: Resultsmentioning

confidence: 99%

“…Annealing temperatures for the new primer sets were optimized using a range of DNA samples extracted from pure cultures (Table 2) to determine the temperatures that gave the best specificity without a reduction in yield. The final thermal cycling conditions used for 355F/1068R were 30 cycles of 94°C for 1 min, 52°C for 1 min and 72°C for 1 min 30 s. For 109F/1401R a touchdown protocol (McPherson and Moller, 2000) was used to improve specificity, consisting of 20 cycles of 94°C for 1 min, 70°C (decreasing by 0.5°C every cycle) for 30 s, 72°C for 2 min followed by 10 cycles with an annealing temperature of 60°C. A similar protocol was used for 344F/1202R consisting of 16 cycles of 94°C for 1 min, 72°C (decreasing by 0.5°C every cycle) for 30 s, 72°C for 2 min followed by 14 cycles with an annealing temperature of 65°C.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Investigation of the methanogen population structure and activity in a brackish lake sediment

Banning

Brock

Fry

et al. 2005

Environmental Microbiology

View full text Add to dashboard Cite

The methanogen community in sediment from the edge of a small brackish lake connected to the Beaulieu Estuary (Hampshire, UK) was investigated by analysis of 16S rRNA gene diversity using new methanogen-specific primers plus Archaea-specific primers. 16S rRNA gene primers previously used for polymerase chain reaction (PCR) detection of methanogenic Archaea from a variety of environments were evaluated by in silico testing. The primers displayed variable coverage of the four main orders of methanogens, highlighting the importance of this type of primer evaluation. Three PCR primer sets were designed using novel reverse primers to facilitate specific amplification of the orders Methanomicrobiales/Methanosarcinales, Methanobacteriales and Methanococcales. Diversity of the methanogen functional gene, methyl coenzyme M reductase (mcrA), was also studied. All gene libraries constructed from this sediment indicated that Methanomicrobiales and Methanosarcinales were the only methanogens detected. There was good agreement between the relative sequence abundances in the methanogen-specific 16S rRNA gene library and terminal restriction fragment length polymorphism (T-RFLP) profiling, suggesting that the population was dominated by putative H2 CO2 utilizing Methanomicrobiales, although acetate-utilizing methanogens were also present. The methanogen population analyses were in agreement with methanogenic activity measurements, which indicated that bicarbonate methanogenesis was higher than acetate methanogenesis at all depths measured and overall there was a significant difference (P = 0.001) between the rates of the two pathways. This study demonstrates the utility of new 16S rRNA gene PCR primers targeting specific methanogenic orders, and the combined results suggest that the CO2 reduction pathway dominates methanogenesis in the brackish sediment investigated.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Investigation of the methanogen population structure and activity in a brackish lake sediment

Banning

Brock

Fry

et al. 2005

Environmental Microbiology

View full text Add to dashboard Cite

show abstract

“…Compared to other detectors, SYBR Green can be universally used in various prints because of its non-specific nature that it can bind to any double-stranded DNA, and it is cheaper, simpler to use, and more stable at elevated temperatures. Also, it does not interfere with DNA Polymerase (McPherson and Simon, 2006).…”

Section: Resultsmentioning

confidence: 99%

Real-Time PCR-based detection of bovine DNA by specific targeting on cytochrome-B

Salamah

Erwanto²,

Martono³

et al. 2019

Pharmaciana

View full text Add to dashboard Cite

The design of specific primers is an interesting research topic such that it offers selective, specific, and effective DNA analysis using real-time PCR. This research was intended to detect bovine DNA using real-time PCR and specific primers to ensure the halal authenticity of food products. Primers of bovine DNA sequences were designed in the NCBI and Primer-BLAST programs. The outcome validation was assessed using several parameters, namely specificity, repeatability, and linearity by real-time PCR. Primer specificity test was performed on fresh tissue (pork and negative control), while the repeatability test used six replications and was based on the calculated coefficient of variation (CV). In the linearity test, six different DNA concentrations (50000, 10000, 5000, 500, 100, and 50 pg/µL) were examined to obtain the efficiency value. Using the specific primer from Cytochrome-B, the real-time PCR could specifically identify the presence of bovine DNA at the optimum annealing temperature of 58.7 0 C. The repeatability analysis yielded a coefficient of variation (CV) of 0.57 %, while the linearity test produced an efficiency value of 206 %. These figures confirm that the method employed in this study is not only specific but also sensitive and reliable for detecting bovine DNA. Real-time PCR using specific primer targeting on the cytochrome-B region of bovine DNA (forward: CTACTGACACTCACATGAATTGG; reverse CACTAGGATGAGGAGAAAGTATAGG) can be used to identify bovine DNA and distinguish it from porcine DNA.

show abstract

“…Íàéóaeèâàí³øèì òèïîì ê³ëüê³ñíîãî àíàë³çó âì³ñòó ÄÍÊ ó çðàçêó º ÏËÐ ó ðåàëüíîìó ÷àñ³ [14], îäíàê ¿¿ çàñòîñóâàííÿ äëÿ íàéá³ëüø ïîøèðåíèõ òà äîñë³äaeåíèõ òèï³â ìàðêåð³â º ïðîáëåìàòè÷íèì, îñê³ëüêè ó âèïàäêó SSR òà SNP â³äì³íí³ñòü ì³ae äâîìà àëåëÿìè ïîëÿãàº ëèøå â îäíîìó àáî ê³ëüêîõ íóêëåîòèäàõ. Äëÿ îñòàííüîãî òèïó ìàðêåð³â ðîçðîáëåíî ñèñòåìó ê³ëüê³ñíîãî àíàë³çó, ÿêà ïåðåäáà÷àº âèêîðèñòàííÿ ãàçî-ð³äèííî¿ õðîìàòîãðàô³¿ äëÿ ðîçïî-ä³ëó àëåë³â [15].…”

Section: ðîñëèííèöòâîunclassified

Method for determination of varietal purity (typicality), hybridity, sterility of seed lots based on the establishment of the quantitative ratio of alleles of DNA markers

Вдовиченко¹,

Спиридонов²,

Хомутовська³

et al. 2016

Plant Varieties Studying and Protection

View full text Add to dashboard Cite

PCR

Cited by 48 publications

References 0 publications

Investigation of the methanogen population structure and activity in a brackish lake sediment

Investigation of the methanogen population structure and activity in a brackish lake sediment

Real-Time PCR-based detection of bovine DNA by specific targeting on cytochrome-B

Method for determination of varietal purity (typicality), hybridity, sterility of seed lots based on the establishment of the quantitative ratio of alleles of DNA markers

Contact Info

Product

Resources

About