Peptidoglycan recognition proteins (PGRPs)

Dziarski, Roman

doi:10.1016/j.molimm.2003.10.011

Cited by 411 publications

(410 citation statements)

References 55 publications

(36 reference statements)

Supporting

Mentioning

406

Contrasting

Unclassified

Order By: Relevance

“…Viral infection has also been found to modulate levels of AMPs in several studies, but the mechanism underlying this effect is very complex and requires further investigations (Danihlík et al, 2015). Immune response F: TGGATGGCAAAGAATTTGGT R: ATTGCAACATTGCCTTAGCC eIF-S8 (Grozinger et al, 2003) Housekeeping gene F: TGAGTGTCTGCTATGGATTGCAA R: TCGCGGCTCGTGGTAAA GAPDH-1 (Huang et al, 2012) Housekeeping gene F: GCTGGTTTCATCGATGGTTT R: ACGATTTCGACCACCGTAAC One differentially expressed gene (GB47805) encodes for a peptidoglycan recognition protein that functions as patternrecognition and effector molecule in innate immunity (Dziarski and Gupta, 2006), while another gene (GB45779) encodes for a UNC93-like protein, which is involved in the innate immune response by regulating Toll-like receptors signalling (Kim et al, 2008). Finally, another DEG (GB42981) encodes a beta1,3-glucan recognition protein that stimulates prophenoloxydase activation and melanization, which is important for wound healing and encapsulation (S€ oderh€ all and Cerenius, 1998).…”

Section: Resultsmentioning

confidence: 99%

Transcriptional signatures of parasitization and markers of colony decline in Varroa-infested honey bees (Apis mellifera)

Zanni

Galbraith

Annoscia

et al. 2017

Insect Biochemistry and Molecular Biology

View full text Add to dashboard Cite

Section: Resultsmentioning

confidence: 99%

Transcriptional signatures of parasitization and markers of colony decline in Varroa-infested honey bees (Apis mellifera)

Zanni

Galbraith

Annoscia

et al. 2017

Insect Biochemistry and Molecular Biology

View full text Add to dashboard Cite

“…73 The free amine of the N-terminus of lipoproteins are acylated with a S- (2,3-diacyloxypropyl) cysteinyl residue which constitutes the immunostimulatory moiety 74 as shown by studies on synthetic peptides containing the diacylthioglycerol unit (see below). 72 In contradistinction to enterobacterial LPS which is recognized by TLR4, PGN, 75 LTA, 76 lipopeptides, 77 as well as some non-enterobacterial LPS 78 signal via TLR2. One of the earliest reports on bacterial components other than LPS was the study by Melchers et al 79 showing that purified lipoprotein from the outer membrane of E. coli was a B-lymphocyte mitogen, expressing activity in LPS-nonresponder C3H/HeJ mice.…”

Section: Tlr4 Agonists-lipopolysaccharide Monophosphoryl Lipid a Andmentioning

confidence: 99%

Potential adjuvantic properties of innate immune stimuli

et al. 2009

View full text Add to dashboard Cite

Just as the prescient comment by Gaston Ramon was relegated to the last footnote of his 1926 paper, 1 so has research on the mechanisms of action of adjuvants, until recently, languished as parenthetical annotations and addenda in the archives of immunology and vaccine development. Ramon defined immunological adjuvants as "substances used in combination with a specific antigen that produced a more robust immune response than the antigen alone." Interestingly enough, he was referring to his empirical findings that the addition of bread crumbs, tapioca, saponin and 'starch oil' to antigenic preparations greatly enhanced antibody responses to diphtheria or tetanus. 2 A year later, the adjuvanticity of aluminum salts (primarily phosphate and hydroxide) was discovered by Glenny and coworkers. 3 In the 83 years that have elapsed, the repertoire of investigational adjuvants has grown to encompass a very wide range of materials, 4 but aluminum salt-based mineral salts (generically, and incorrectly, termed "alum") have remained the only adjuvants currently approved by the FDA. Aluminum salts have enjoyed a good safety record, but they are weak adjuvants for antibody induction and induce a T helper-2 (T H 2)-skewed, rather than a T helper-1 (T H 1) response. 5,6 Furthermore, not only are aluminum salts ineffective at inducing cytotoxic T lymphocyte (CTL) or mucosal IgA antibody responses, but also have a propensity to induce IgE responses, which have been associated with allergic reactions in some subjects. 5,6 Very recent reports implicate the Nalp3 inflammasome, a component of the innate immune response, as the effector limb of alum-associated adjuvanticity. [7][8][9] In 1962, Dresser observed that injection of purified soluble proteins not only failed to stimulate an immune response, but tolerized animals unless a bacterial extract was admixed with the protein immunogen. 10 This led him to redefine adjuvanticity as "a property of a substance which can act as a physiological switch, directing at least some immunologically competent cells to respond by making antibody rather than by becoming immunologically paralyzed by the antigen," 11 confirming Johnson's earlier observations that lipopolysaccharide (LPS) from Gram-negative bacteria exerted potent adjuvant properties, 12 and perhaps paved the way for the subsequent discovery of the wide range of microorganism-derived adjuvants. 13 TLRs are pattern recognition receptors present on diverse cell types that recognize specific molecular patterns present in molecules that are broadly shared by pathogens but distinguishable from host molecules, collectively referred to as pathogen-associated molecular patterns (PAMPs). 14,15 There are 10 TLRs in the human genome;

show abstract

“…Based on molecular weight, PGRPs are classified into three types, i.e. short-, intermediate-, and longPGRPs (PGRP-S, PGRP-I, and PGRP-L, respectively) [5]. In fruit fly, PGRPs are grouped into two classes: PGRP-SA, -SB1, -SB2, -SC1A, -SC1B, -SC2, and -SD, which have short transcripts, and PGRP-LA, -LB, -LC, -LD, and -LE, which have long transcripts [6].…”

Section: Introductionmentioning

confidence: 99%

“…In fruit fly, PGRPs are grouped into two classes: PGRP-SA, -SB1, -SB2, -SC1A, -SC1B, -SC2, and -SD, which have short transcripts, and PGRP-LA, -LB, -LC, -LD, and -LE, which have long transcripts [6]. In humans, four types of PGRPs have been identified, which were named PGLYRP-1, PGLYRP-2, PGLYRP-3, and PGLYRP-4 [5].…”

Section: Introductionmentioning

confidence: 99%