Permanent Genetic Resources added to Molecular Ecology Resources Database 1 May 2009–31 July 2009

Almany, Glenn R.; Arruda, Maysa Silva; Arthofer, Wolfgang; Atallah, Zahi K.; Beissinger, Steven R.; Berumen, Michael L.; Bogdanowicz, Steven M.; Brown, Stacy D.; Bruford, Michael William; Burdine, Charles; Busch, Jeremiah W.; Campbell, Nathan R.; Carey, David W.; Carstens, Bryan C.; Chu, Ka Hou; Cubeta, Marc A.; Cuda, James P.; Cui, Zhaoxia; Datnoff, Lawrence E.; Dávila, José A.; Davis, Emily S.; Davis, R. M.; Diekmann, Onno E.; Eizirik, Eduardo; Fargallo, Juan A.; Fernandes, Felipe Amorim; Fukuda, Hideo; Gale, Liane Rosewich; Gallagher, Elizabeth; Gao, Yongqiang; Girard, Philippe; Godhe, Anna; Gonçalves, Evonnildo Costa; Gouveia, Licínia; Grajczyk, Amber Marie; Grose, Michael J.; Gu, Zhennan; Halldén, Christer; Härnström, Karolina; Hemmingsen, Amanda Heather; Holmes, Gerald J.; Huang, Cuiping; Huang, Chun Fa; Hudman, Stephen P.; Jones, Geoffrey P.; Kanetis, Loukas; Karunasagar, Iddya; Karunasagar, Indrani; Keyghobadi, Nusha; Klosterman, Steve J.; Klug, Page E.; Koch, Jennifer; Koopman, Margaret M.; Köppler, Kirsten; Koshimizu, Eriko; Krumböck, Susanne; Kubisiak, Thomas L.; Landis, Jacob B.; Lasta, Mario; LEE, CHOW‐YANG; Li, Qianqian; Li, Shou‐Hsien; Lin, Rong‐Chien; LIU, M.; LIU, NA; LIU, W. C.; Liu, Yuan; Loiseau, Anne; Luan, Weisha; MARUTHACHALAM, K. K.; McCormick, Helen; Mellick, Rohan; Monnahan, Patrick J.; Morielle‐Versute, Eliana; Murray, Tomás E.; Narum, Shawn R.; Neufeld, Katie; Nova, Pedro J. G. De; Ojiambo, Peter S.; Okamoto, Nobuaki; Othman, Ahmad Sofiman; Overholt, William A.; Pardini, Renata; Paterson, Ian G.; PATTY, OLIVIA A.; Paxton, Robert J.; Planes, Serge; Porter, Carolyn; Pratchett, Morgan S.; Püttker, Thomas; Rašić, Gordana; Rasool, Bilal; Rey, Olivier; Riegler, Markus; Riehl, Christina; Roberts, John M. K.; Roberts, Pamela D.; Rochel, Elisabeth; Roe, Kevin J.; Rossetto, Maurizio; Ruzzante, Daniel E.; Sakamoto, Takashi; Saravanan, V.; Sarturi, Cladinara Roberts; Schmidt, Anke; Schneider, Maria Paula Cruz; Schuler, Hannes; Serb, Jeanne M.; Serrão, Ester T. A.; Shi, Yaohua; SILVA, ARTUR; Sin, Yeng Wong; Sommer, Simone; Stauffer, Christian; Strüssmann, Carlos Augusto; Subbarao, Krishna V.; Syms, Craig; Tan, Feng; Tejedor, Eugenio Daniel; Thorrold, Simon R.; Trigiano, Robert N.; Trucco, María I.; Tsuchiya-Jerep, Mirian T. N.; Vergara, Pablo M.; Vliet, Mirjam S. van de; Wadl, Phillip A.; WANG, AIMIN; WANG, HONGXIA; WANG, R. X.; Wang, Xinwang; Wang, Yan; Weeks, Andrew R.; Wei, Fuwen; Werner, W.J.; Wiley, E. O.; Williams, Dean A.; Wilkins, Richard J.; Wisely, Samantha M.; With, Kimberly A.; Wu, Dengsheng; Yao, Cheng‐Te; Yau, Cynthia; Yeap, Beng-Keok; Zhai, Baoping; Zhan, Xiangjiang; Zhang, Guoyan; ZHANG, S. Y.; Zhao, Ru; Zhu, Lifeng

doi:10.1111/j.1755-0998.2009.02759.x

Cited by 113 publications

(42 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For each sample, DNA was extracted using a modified alcohol extraction method similar to Sambrook, Fritsch, and Maniatas (1989). Six microsatellite loci were then amplified for Q. quadrula samples (C4, C114, A112, A130, R9, and D102) using polymerase chain reaction (PCR) and primers designed by Hemmingsen, Roe, and Serb (2009) for a close relative, the Winged Mapleleaf ( Q. fragosa ), and optimized for Q. quadrula (Paterson, Griffith, Krebs, Burlakova, & Zanatta, 2015). Each PCR reaction consisted of 1.0 μa of a DNA sample (extracted DNA diluted 1:10 in nanopure water) and 9.0 μw of PCR cocktail [1× Taq buffer, bovine serum albumin (BSA), deoxyribonucleotide phosphate (dNTP), forward and reverse primers, MgCl 2 and Taq DNA polymerase, as in Paterson et al.…”

Section: Methodsmentioning

confidence: 99%

Detection of barriers to dispersal is masked by long lifespans and large population sizes

Hoffman

Willoughby

Swanson

et al. 2017

Ecology and Evolution

View full text Add to dashboard Cite

Population genetic analyses of species inhabiting fragmented landscapes are essential tools for conservation. Occasionally, analyses of fragmented populations find no evidence of isolation, even though a barrier to dispersal is apparent. In some cases, not enough time may have passed to observe divergence due to genetic drift, a problem particularly relevant for long‐lived species with overlapping generations. Failing to consider this quality during population structure analyses could result in incorrect conclusions about the impact of fragmentation on the species. We designed a model to explore how lifespan and population size influence perceived population structure of isolated populations over time. This iterative model tracked how simulated populations of variable lifespan and population size were affected by drift alone, using a freshwater mussel, Quadrula quadrula (mapleleaf), as a model system. In addition to exhibiting dramatic lifespan variability among species, mussels are also highly imperiled and exhibit fragmentation by dams throughout the range of many species. Results indicated that, unless population size was small (<50 individuals) or lifespan short (<22 years), observing genetic divergence among populations was unlikely. Even if wild populations are isolated, observing population structure in long‐lived mussels from modern damming practices is unlikely because it takes longer for population structure to develop in these species than most North American dams have existed. Larger population sizes and longer lifespans increase the time needed for significant divergence to occur. This study helps illuminate the factors that influence genetic responses by populations to isolation and provides a useful model for conservation‐oriented research.

show abstract

Section: Methodsmentioning

confidence: 99%

Detection of barriers to dispersal is masked by long lifespans and large population sizes

Hoffman

Willoughby

Swanson

et al. 2017

Ecology and Evolution

View full text Add to dashboard Cite

show abstract

“…Eight microsatellite loci were amplified (S.mar1 -8) [26] by PCR as described in [4]. The products were analysed in an ABI 3730 (Applied Biosystems) and allele sizes were assigned relative to the internal standard (GS600LIZ).…”

Section: Methodsmentioning

confidence: 99%

Seascape analysis reveals regional gene flow patterns among populations of a marine planktonic diatom

et al. 2013

Self Cite

View full text Add to dashboard Cite

We investigated the gene flow of the common marine diatom, Skeletonema marinoi, in Scandinavian waters and tested the null hypothesis of panmixia. Sediment samples were collected from the Danish Straits, Kattegat and Skagerrak. Individual strains were established from germinated resting stages. A total of 350 individuals were genotyped by eight microsatellite markers. Conventional F-statistics showed significant differentiation between the samples. We therefore investigated whether the genetic structure could be explained using genetic models based on isolation by distance (IBD) or by oceanographic connectivity. Patterns of oceanographic circulation are seasonally dependent and therefore we estimated how well local oceanographic connectivity explains gene flow month by month. We found no significant relationship between genetic differentiation and geographical distance. Instead, the genetic structure of this dominant marine primary producer is best explained by local oceanographic connectivity promoting gene flow in a primarily south to north direction throughout the year. Oceanographic data were consistent with the significant F ST values between several pairs of samples. Because even a small amount of genetic exchange prevents the accumulation of genetic differences in F-statistics, we hypothesize that local retention at each sample site, possibly as resting stages, is an important component in explaining the observed genetic structure.

show abstract

“…The isolates were further characterized using microsatellite markers that were developed by Cheng-Hua Huang for populations of F. oxysporum f. sp. radicis-lycopersici (22). Among the 27 microsatellite loci proposed (22), we selected the following five loci with high numbers of alleles: FOL20 (forward primer, CATTGAGGAAGAGCGGAAAG; reverse primer, CACATTTGGCACAGCAATCT), FOL35 (forward primer, GT CGTTTTCAAGGACGCACT; reverse primer, GGTGGCAGTTTCCT CCTTTT), FOL296 (forward primer, CACTGAAGGAAATGCAG CAG; reverse primer, TAGGCTCTGGAGATGCTTGG), FOL624 (forward primer, CAAGAGGCCAGCGATAGTGT; reverse primer, AGC TTTTGATACCCCATTCG), and CH2-15 (forward primer, ATCTTCCT CACGGTTTTGGA; reverse primer, TGTAGCGTAGCACAACAGTGG).…”

Section: Methodsmentioning

confidence: 99%

“…radicis-lycopersici (22). Among the 27 microsatellite loci proposed (22), we selected the following five loci with high numbers of alleles: FOL20 (forward primer, CATTGAGGAAGAGCGGAAAG; reverse primer, CACATTTGGCACAGCAATCT), FOL35 (forward primer, GT CGTTTTCAAGGACGCACT; reverse primer, GGTGGCAGTTTCCT CCTTTT), FOL296 (forward primer, CACTGAAGGAAATGCAG CAG; reverse primer, TAGGCTCTGGAGATGCTTGG), FOL624 (forward primer, CAAGAGGCCAGCGATAGTGT; reverse primer, AGC TTTTGATACCCCATTCG), and CH2-15 (forward primer, ATCTTCCT CACGGTTTTGGA; reverse primer, TGTAGCGTAGCACAACAGTGG). For each microsatellite locus, PCR amplification was performed in a final volume of 20 l, containing 10 ng of DNA, 0.15 M each primer, 50 M each deoxyribonucleotide triphosphate (dNTP), 2.5 mM MgCl 2 , 1 U of Taq polymerase (MP Biomedicals, Illkirch, France), and 1ϫ PCR buffer.…”

Section: Methodsmentioning

confidence: 99%

“…Microsatellites are also highly polymorphic loci with rapid mutation rates and are thus powerful means to characterize intraspecific diversity within fungi and to discriminate closely related isolates (21). Such microsatellite markers were developed to study the diversity of F. oxysporum populations (22). In addition, vegetative compatibility testing has been extensively used to evaluate genetic diversity in phytopathogenic populations of F. oxysporum and to assign isolates to vegetative compatibility groups (VCGs) (23,24).…”

mentioning

confidence: 99%

See 1 more Smart Citation

A Clonal Lineage of Fusarium oxysporum Circulates in the Tap Water of Different French Hospitals

Edel-Hermann

Sautour

Gautheron

et al. 2016

Appl Environ Microbiol

View full text Add to dashboard Cite

Fusarium oxysporum is typically a soilborne fungus but can also be found in aquatic environments. In hospitals, water distribution systems may be reservoirs for the fungi responsible for nosocomial infections. F. oxysporum was previously detected in the water distribution systems of five French hospitals. Sixty-eight isolates from water representative of all hospital units that were previously sampled and characterized by translation elongation factor 1␣ sequence typing were subjected to microsatellite analysis and full-length ribosomal intergenic spacer (IGS) sequence typing. All but three isolates shared common microsatellite loci and a common two-locus sequence type (ST). This ST has an international geographical distribution in both the water networks of hospitals and among clinical isolates. The ST dominant in water was not detected among 300 isolates of F. oxysporum that originated from surrounding soils. Further characterization of 15 isolates by vegetative compatibility testing allowed us to conclude that a clonal lineage of F. oxysporum circulates in the tap water of the different hospitals. IMPORTANCEWe demonstrated that a clonal lineage of Fusarium oxysporum inhabits the water distribution systems of several French hospitals. This clonal lineage, which appears to be particularly adapted to water networks, represents a potential risk for human infection and raises questions about its worldwide distribution. N osocomial infections caused by members of the genus Fusarium have emerged over the past 2 decades (1, 2). Infections caused by Fusarium isolates may be superficial, such as keratitis and onychomycosis, but Fusarium spp. can also cause life-threatening disseminated infections in immunocompromised patients (3). The Fusarium species most often involved are the morphological species Fusarium solani and Fusarium oxysporum (4, 5). These morphological species are now recognized as species complexes due to their high level of phylogenetic diversity (6, 7).Members of the genus Fusarium have a diverse ecology that is linked to an impressive metabolic diversity together with a high genetic diversity. They are primarily known as saprophytes in the environment and are usually found in all types of soils (8-10), and they are frequently associated with plants as saprophytes, endophytes, or pathogens (9, 11). Fusaria may also be found in aquatic habitats, including natural water environments (12, 13) and drinking water distribution systems (14-17).Water distribution systems in hospitals were identified as potential reservoirs for species of Fusarium, where they are thought to be responsible for nosocomial infections (14, 18). Fusaria in water may be aerosolized into the air when the water passes through taps and showers and then inhaled by immunocompromised patients (14). In two previous studies, we detected F. oxysporum in the water distribution systems of different French hospitals, with high concentrations of up to 10 5 propagules liter Ϫ1 in some units (19,20). Heterogeneous distributions according to...

show abstract

Permanent Genetic Resources added to Molecular Ecology Resources Database 1 May 2009–31 July 2009

Cited by 113 publications

References 0 publications

Detection of barriers to dispersal is masked by long lifespans and large population sizes

Detection of barriers to dispersal is masked by long lifespans and large population sizes

Seascape analysis reveals regional gene flow patterns among populations of a marine planktonic diatom

A Clonal Lineage of Fusarium oxysporum Circulates in the Tap Water of Different French Hospitals

Contact Info

Product

Resources

About