Phosphorylcholine Expression by NontypeableHaemophilus influenzaeCorrelates with Maturation of Biofilm Communities In Vitro and In Vivo

Abstract

Nontypeable Haemophilus influenzae (NTHI) causes chronic infections that feature the formation of biofilm communities. NTHI variants within biofilms have on their surfaces lipooligosaccharides containing sialic acid (NeuAc) and phosphorylcholine (PCho). Our work showed that NeuAc promotes biofilm formation, but we observed no defect in the initial stages of biofilm formation for mutants lacking PCho. In this study, we asked if alterations in NTHI PCho content affect later stages of biofilm maturation. Biofilm communities were compared for NTHI 2019 and isogenic mutants that either lacked PCho (NTHI 2019 licD) or were constitutively locked in the PCho-positive phase (NTHI 2019 lic ON ). Transformants expressing green fluorescent protein were cultured in continuous-flow biofilms and analyzed by confocal laser scanning microscopy. COMSTAT was used to quantify different biofilm parameters. PCho expression correlated significantly with increased biofilm thickness, surface coverage, and total biomass, as well as with a decrease in biofilm roughness. Comparable results were obtained by scanning electron microscopy. Analysis of thin sections of biofilms by transmission electron microscopy revealed shedding of outer membrane vesicles by NTHI bacteria within biofilms and staining of matrix material with ruthenium red in biofilms formed by NTHI 2019 lic ON . The biofilms of all three strains were comparable in viability, the presence of extracellular DNA, and the presence of sialylated moieties on or between bacteria. In vivo infection studies using the chinchilla model of otitis media showed a direct correlation between PCho expression and biofilm formation within the middle-ear chamber and an inverse relationship between PCho and persistence in the planktonic phase in middle-ear effusions. Collectively, these data show that PCho correlates with, and may promote, the maturation of NTHI biofilms. Further, this structure may be disadvantageous in the planktonic phase.Nontypeable Haemophilus influenzae (NTHI) is a commensal of the human upper airways that can cause localized opportunistic airway infections when mucociliary defenses are compromised (24). NTHI is a leading cause of otitis media with effusion (2), acute otitis media (1), chronic sinusitis (20), and pulmonary infections associated with chronic obstructive pulmonary disease (31). For many of these infections, NTHI bacteria persist within dense biofilm communities that are thought to provide resistance to host clearance (12,25,29). NTHI biofilms contain variants expressing lipooligosaccharides (LOS) that contain phosphorylcholine (PCho) and sialic acid (NeuAc) (10,19,36,41). Mutants lacking these structures are unable to establish persistent biofilms in vivo (14,19,36). The addition of PCho to LOS occurs in a phase-variable manner, and thus, NTHI populations contain discrete subpopulations of PCho-positive (PCho ϩ ) and PCho-negative (PCho Ϫ ) variants (40). PCho contributes to NTHI colonization and persistence by promoting bacterial adherence to host cells (9,32,...

Nontypeable Haemophilus influenzae Initiates Formation of Neutrophil Extracellular Traps

“…For NTHI, the available evidence indicates that NETs do not mediate significant bacterial clearance; in fact, they are positively correlated with higher bacterial loads within middle-ear fluids and surface-attached communities in the chinchilla infection model (22). Notably, our recent work shows striking parallels between lipooligosaccharide modifications that promote NTHI survival within NETs (22) and those that promote NTHI biofilm formation (18,23,24,29,45).…”

“…For NTHI, determinants of biofilm formation include lipooligosaccharides (18,23,24,29,36,45), pili (27,28), and extracellular DNA (27). In most cases, these factors have been shown to be required for persistent infections in animal models (2,3,23,24,29,38,39,45).…”

“…Biofilms have long been thought to promote microbial resistance to pharmaceutical or immune clearance during persistent infections (17,20). Bacterial factors important to NTHI biofilms include specific subsets of lipooligosaccharides (LOS) containing sialic acid and/or phosphorylcholine (23,24,45), pili (28), and double-stranded DNA (25,27). Our recent work demonstrated that NTHI biofilms also have a significant host component, including a double-stranded DNA lattice decorated with histones and elastase, that fits the defining traits of a neutrophil extracellular trap (NET) (22).…”

Comprehensive Proteomic and Metabolomic Signatures of Nontypeable Haemophilus influenzae-Induced Acute Otitis Media Reveal Bacterial Aerobic Respiration in an Immunosuppressed Environment

“…ChoP modification is important for NTHI colonization and persistence in AOM because of roles in biofilm formation, adherence to cells through the PAF receptor, survival of complement-mediated lysis, as well as resistance to antimicrobial peptides (121)(122)(123)(124)(125)(126)(127). The significant reduction of PC derivatives could be because of decreases in biosynthesis or use as a preferential substrate for glycan modification by NTHI.…”

Involvement of clathrin and -arrestins in Aggregatibacter actinomycetemcomitans endocytosis of human vascular endothelial cells

“…PC not only plays an important role in S. pneumoniae adherence and invasion of host cells (Cundell et al, 1995), but also enhances H. influenzae biofilm maturation (Hong et al, 2007 Plasmid Sequence ARRB1-3 5'-GGATCCTGAGTATCTCAAAGATTCAAGAGATCTTTGAGATACTCAGGATCCTT -3' ARRB2-1 5'-GGACCAGGGTCTTCAAGAAGTTTCAAGAGAACTTCTTGAAGACCCTGGTCCTT -3' ARRB-NC 5'-GTTCTCCGAACGTGTCACGT CAAGAGATT ACGTGACACGTTCGGAGAA TT -3' Table 2. Primers used in real time PCR.…”