Photochemical cross-linking studies on the interaction of Escherichia coli RNA polymerase with T7 DNA

Hillel, Zaharia; Wu, Cheng‐Wen

doi:10.1021/bi00608a003

Cited by 77 publications

(38 citation statements)

References 49 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…and o were labeled [9]. However, no DNA binding can be observed for the B subunit alone, consistent with our results from Southwestern assays, but sub-assembled a&3 complexes bind to limited sites on DNA [23].…”

Section: Discussionsupporting

confidence: 88%

Nucleic acid‐binding regions of the second‐largest subunit of Drosophila RNA polymerase II identified by Southwestern blotting

Kontermann

Bautz

1994

FEBS Letters

View full text Add to dashboard Cite

Analysing overlapping bacterially expressed fragments of the second-largest subunit of Drosophila melanogaster RNA polymerase II in Southwestern DNA binding assays we have identified regions that have the potential to bind nucleic acids non-specifically.A region exhibiting strong DNA binding is located in the N-terminal part of the molecule (amino acids 357-504) and some weak DNA binding is observed for the C-terminal part (amino acids 860-l 160). The non-specific DNA binding behavior of these regions is similar to that of the native enzyme. Most of the known mutations responsible for rifampicin resistance map to a region of the Escherichia colip subunit corresponding to the N-terminal nucleic acid-binding region, indirectly supporting the notion that this region participates in interaction with the RNA transcript in ternary complexes.

show abstract

Section: Discussionsupporting

confidence: 88%

Nucleic acid‐binding regions of the second‐largest subunit of Drosophila RNA polymerase II identified by Southwestern blotting

Kontermann

Bautz

1994

FEBS Letters

View full text Add to dashboard Cite

show abstract

“…Treatment of irradiated binding mixtures with either greater amounts of nuclease or the same amount of nuclease but for longer times did not alter the mobility of the 46-kDa species. Since the covalent attachment of short oligonucleotides to proteins has only a minor effect on the mobility of these proteins in SDS-polyacrylamide gel electrophoresis (11), these experiments indicate that a protein of approximately 46 kDa binds specifically to the MLTF-binding site.…”

Section: Resultsmentioning

confidence: 85%

A single polypeptide possesses the binding and transcription activities of the adenovirus major late transcription factor.

Chodosh¹,

Carthew²,

Sharp³

1986

Mol. Cell. Biol.

425

261

View full text Add to dashboard Cite

A simple approach has been developed for the unambiguous identification and purification of sequencespecific DNA-binding proteins solely on the basis of their ability to bind selectively to their target sequences. Four independent methods were used to identify the promoter-specific RNA polymerase II transcription factor MLTF as a 46-kilodalton (kDa) polypeptide. First, a 46-kDa protein was specifically cross-linked by UV irradiation to a body-labeled DNA fragment containing the MLTF binding site. Second, MLTF sedimented through glycerol gradients at a rate corresponding to a protein of native molecular weight 45,000 to 50,000. Third, a 46-kDa protein was specifically retained on a biotin-streptavidin matrix only when the DNA fragment coupled to the matrix contained the MLTF binding site. Finally, proteins from the most highly purified fraction which were eluted and renatured from the 44-to 48-kDa region of a sodium dodecyl sulfate-polyacrylamide gel exhibited both binding and transcription-stimulatory activities. The DNA-binding activity was purified 100,000-fold by chromatography through three conventional columns plus a DNA affinity column. Purified MLTF was characterized with respect to the kinetic and thermodynamic properties of DNA binding. These parameters indicate a high degree of occupancy of MLTF binding sites in vivo.The rate of transcription initiation is an important determinant of gene expression in eucaryotic organisms. Considerable effort has been devoted to elucidating the molecular mechanisms responsible for regulating the transcription initiation rate of specific genes. Genetic analysis of RNA polymerase II transcription units has defined at least three qualitatively different types of cis-acting DNA regulatory elements: the TATA box, upstream promoter elements, and transcriptional enhancers. Recently, the gel electrophoresis DNA-binding assay and the DNase footprinting assay have been used to demonstrate that each of these types of elements interacts with one or more sequence-specific DNAbinding proteins (4,6,21,23). Furthermore, proteins which bind to the TATA box and to at least three distinct upstream promoter elements have been shown to stimulate transcription in vitro by RNA polymerase II (4,5,6,21,22,32). One of these transcription factors, MLTF or USF, binds to and stimulates transcription from the major late promoter (MLP) of adenovirus (4,18,32). An understanding of the mechanisms by which MLTF and other transcription factors control transcription initiation requires the identification, purification, and characterization of these proteins. In addition, isolation of the genes encoding these proteins will permit study of their regulation during the course of cell growth and development and will allow genetic analysis of the structural characteristics which specify their transcriptional interactions.The existence of MLTF was first suggested by the dependence in vivo of transcription from the adenovirus type 2 MLP on sequences located 50 to 66 base pairs (bp) upstream of the transcription...

show abstract

“…To analyze the apparent size distribution of the polypeptides that interact with FIB-2.6 DNA, a UV cross-linking assay was developed (15,33). This technique creates covalent links between DNA and the amino acid side chains of a binding protein (3,16,26,40).…”

Section: Resultsmentioning

confidence: 99%

“…To determine the composition of NFI polypeptides in each GMS complex, the complexes were fractionated on a nondenaturing polyacrylamide gel (6,39,47), the gel was UV irradiated, and the GMS complexes were excised, boiled in SDS buffer, and analyzed by SDS-polyacrylamide gel electrophoresis. Since the frequency of cross-linking is very low (<5% [15,33]), the probability of having more than one NFI monomer cross-linked to the same DNA fragment is negli-VOL. 10,1990 on (Fig.…”

Section: Resultsmentioning

confidence: 99%

Analysis of multiple forms of nuclear factor I in human and murine cell lines.

Goyal¹,

Knox²,

Gronostajski³

1990

Mol. Cell. Biol.

View full text Add to dashboard Cite

Nuclear factor I (NFI) is a group of related site-specific DNA-binding proteins that function in adenovirus DNA replication and cellular RNA metabolism. We have measured both the levels and forms of NFI that interact with a well-characterized 26-base-pair NFI-binding site. Five different NFI-DNA complexes were seen in HeLa nuclear extracts by using a gel mobility shift (GMS) assay. In addition, at least six forms of NFI were shown to cross-link directly to DNA by using a UV cross-linking assay. (13,30,34,36,46). Analysis of this site and a number of other NFI-binding sites revealed a consensus sequence, TGGC/A(N)5GCCAA, required for optimal binding (4, 9, 11). In addition, flanking sequences and the length and composition of the 5-base-pair spacer region can greatly modulate binding efficiency (9).NFI-binding sites are present within the promoters of viral (14, 18, 42) and cellular (7,19,23,38,39) (17,19,41).Purification of NFI from HeLa cells has revealed a number of polypeptides, ranging in size from 52 to 66 kilodaltons (kDa), which constitute a family of NFI proteins (35). In addition, multiple mRNA species encoding NFI-family proteins have been detected from hamster (7), rat (32), porcine (27), and human (27, 41) sources.We have used nitrocellulose filter binding, gel mobility shift (GMS) analysis, and UV cross-linking to assess the levels and forms of NFI present in various cell lines. Multiple specific protein-DNA complexes have been detected in nuclear extracts. In addition, cell-line-specific differences in both the forms and the absolute amounts of NFI binding activity were observed. MATERIALS AND METHODSSynthetic oligonucleotides. Oligonucleotides were made on an Applied Biosystems model 280A DNA synthesizer. Oligonucleotides FIB-2.6 (AGGTCTGGC'ITTGGGCCAAGA * Corresponding author. GCCGC) and FIB-2.6C2 (AGGTCTCGCTTTGGGCCAAG AGCCGC) were made duplex by hybridization of a primer (GCGGCTCTTGGC), followed by extension using the large fragment of DNA polymerase I as previously described (9). When labeled with [a-32P]dCTP, the initial specific activity of the duplex fragments was about 10,000 cpm/fmol.Competitor DNA. Plasmid competitor DNAs were prepared by alkaline lysis and sedimentation through cesium chloride gradients (25). pTAd contains the sequence AATTG GCTTGAAGCCAACTAGATC cloned between the EcoRI and BamHI sites of pTZ18R (Pharmacia, Inc.). This sequence contains the NFI-binding site from the adenovirus type 5 origin of replication with a point mutation that increases binding about fourfold (36; unpublished results). Plasmids pTZEa and pTZTK contain the oligonucleotides ACT'TTTAACCAATCAGAAAAAT and CGAATTCGCCA ATGACAAGACGC, respectively, cloned into the SmaI site of pTZ18R. The Ea oligonucleotide contains the CCAATbinding site for NF-Y/CP1 from the murine major histocompatibility complex class II locus (5), and the TK oligonucleotide contains the CCAAT box from the herpes simplex virus thymidine kinase gene (8).GMS assay. 32P-labeled oligonucleotide (10 fmol) was incubated with crude nuclear extract...

show abstract

Photochemical cross-linking studies on the interaction of Escherichia coli RNA polymerase with T7 DNA

Cited by 77 publications

References 49 publications

Nucleic acid‐binding regions of the second‐largest subunit of Drosophila RNA polymerase II identified by Southwestern blotting

Nucleic acid‐binding regions of the second‐largest subunit of Drosophila RNA polymerase II identified by Southwestern blotting

A single polypeptide possesses the binding and transcription activities of the adenovirus major late transcription factor.

Analysis of multiple forms of nuclear factor I in human and murine cell lines.

Contact Info

Product

Resources

About