Photosensitized and Catalytic Oxidation of Dna by Metallophthalocyanine-Oligonucleotide Conjugates

Koval, Vladimir V.; Chernonosov, Alexander А.; Abramova, Tatyana V.; Иванова, Т. В.; Fedorova, Olga S.; Derkacheva, V. M.; Luk'yanets, E. A.

doi:10.1081/ncn-100002531

Cited by 16 publications

(13 citation statements)

References 2 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The labelled oligonucleotides were prepared using a previously reported method (14). The oligonucleotides were synthesized by standard phosphoramidite chemistry and contained a—O-(CH 2 ) 3 NH 2 linker at the 5′-end.…”

Section: Methodsmentioning

confidence: 99%

Quantitative surface-enhanced resonance Raman scattering of phthalocyanine-labelled oligonucleotides

Macaskill

Chernonosov

Koval

et al. 2007

Nucleic Acids Research

Self Cite

View full text Add to dashboard Cite

The evaluation of phthalocyanine labels for the surface-enhanced resonance Raman scattering (SERRS) detection of oligonucleotides is reported. Three phthalocyanine-labelled oligonucleotides were assessed, each containing a different metal centre. Detection limits for each labelled oligonucleotide were determined using two excitation frequencies where possible. Limits of detection as low as 2.8 × 10−11 mol. dm−3 were obtained which are comparable to standard fluorescently labelled probes used in previous SERRS studies. The identification of two phthalocyanine-labelled oligonucleotides without separation was also demonstrated indicating their suitability for multiplexing. This study extends the range of labels suitable for quantitative surface-enhanced resonance Raman scattering with silver nanoparticles and offers more flexibility and choice when considering SERRS for quantitative DNA detection.

show abstract

Section: Methodsmentioning

confidence: 99%

Quantitative surface-enhanced resonance Raman scattering of phthalocyanine-labelled oligonucleotides

Macaskill

Chernonosov

Koval

et al. 2007

Nucleic Acids Research

Self Cite

View full text Add to dashboard Cite

show abstract

“…The oligonucleotide conjugates with phthalocyanine complexes of Al(III), Zn(II), and Co(II) were synthesized using a previously reported solid-phase method [13] with a 30–40% yield. The conjugates were isolated from the reaction mixture and purified by HPLC in an acetonitrile/water gradient.…”

Section: Experimental Methodsmentioning

confidence: 99%

Conjugates of Phthalocyanines with Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Chernonosov

Koval²,

Knorre³

et al. 2006

Bioinorganic Chemistry and Applications

View full text Add to dashboard Cite

Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen , while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of and 2-mercaptoethanol or in the presence of H2O2. Under both sensitized and catalyzed conditions, the nucleotides were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer.

show abstract

“…Koval et al have first reported in 2001 the synthesis of oligonucleotide-phthalocyanines conjugates for specific DNA modifications in vitro and in vivo, which is of interest for the development of sequence specific gene targeting reagents [92]. Later on, Hammer et al prepared asymmetrical water-soluble Pcs 19-20 conjugated with an oligonucleotide via an isothiocyanate function (Fig.…”

Section: Biotinementioning

confidence: 98%

Phthalocyanines Covalently Bound to Biomolecules for a Targeted Photodynamic Therapy

Taquet¹,

Frochot²,

Manneville³

et al. 2007

CMC

158

View full text Add to dashboard Cite

Photodynamic therapy (PDT) is a relatively new cytotoxic treatment, predominantly used in anticancer approaches, that depends on the retention of photosensitizers in tumor and their activation after light exposure. This technology is based on the light excitation of a photosensitizer which induces very localized oxidative damages within the cells by formation of highly reactive oxygen species, the most important being singlet oxygen. Many photo-activable molecules have been synthesized such as porphyrins, chlorins and more recently phthalocyanines which present a strong light absorption at wavelengths around 670 nm and are therefore well-adapted to the optical window required for PDT application. However, the lack of selective accumulation of these photo-activable molecules within tumor tissue is a major problem in PDT, and one research area of importance is developing targeted photosensitizers. Indeed, targeted photodynamic therapy offers the advantage to enhance photodynamic efficiency by directly targeting diseased cells or tissues. Many attempts have been made to either increase the uptake of the dye by the target cells and tissues or to improve subcellular localization so as to deliver the dye to photosensitive sites within the cells. The aim of this review is to present the actual state of the development of phthalocyanines covalently conjugated with biomolecules that possess a marked selectivity towards cancer cells; for some of them their photophysical properties and photodynamic activity will be presented.

show abstract

Photosensitized and Catalytic Oxidation of Dna by Metallophthalocyanine-Oligonucleotide Conjugates

Abstract: The synthesis of new metallophthalocyanine-oligonucleotide conjugates is reported. These conjugates can cause sequence-specific photosensitized or catalytic oxidation of DNA by molecular oxygen.

Cited by 16 publications

References 2 publications

Quantitative surface-enhanced resonance Raman scattering of phthalocyanine-labelled oligonucleotides

Quantitative surface-enhanced resonance Raman scattering of phthalocyanine-labelled oligonucleotides

Conjugates of Phthalocyanines with Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Phthalocyanines Covalently Bound to Biomolecules for a Targeted Photodynamic Therapy

Contact Info

Product

Resources

About