Physiological relevance and contribution to metal balance of specific and non-specific Metallothionein isoforms in the garden snail, Cantareus aspersus

Abstract

Variable environmental availability of metal ions represents a constant challenge for most organisms, so that during evolution, they have optimised physiological and molecular mechanisms to cope with this particular requirement. Metallothioneins (MTs) are proteins that play a major role in metal homeostasis and as a reservoir. The MT gene/protein systems of terrestrial helicid snails are an invaluable model for the study of metal-binding features and MT isoform-specific functionality of these proteins. In the present study, we characterised three paralogous MT isogenes and their expressed products in the escargot (Cantareus aspersus). The metal-dependent transcriptional activation of the three isogenes was assessed using quantitative Real Time PCR. The metal-binding capacities of the three isoforms were studied by characterising the purified native complexes. All the data were analysed in relation to the trace element status of the animals after metal feeding. Two of the three C. aspersus MT (CaMT) isoforms appeared to be metal-specific, (CaCdMT and CaCuMT, for cadmium and copper respectively). A third isoform (CaCd/CuMT) was non-specific, since it was natively recovered as a mixed Cd/Cu complex. A specific role in Cd detoxification for CaCdMT was revealed, with a 80-90% contribution to the Cd balance in snails exposed to this metal. Conclusive data were also obtained for the CaCuMT isoform, which is involved in Cu homeostasis, sharing about 30-50% of the Cu balance of C. aspersus. No apparent metal-related physiological function was found for the third isoform (CaCd/CuMT), so its contribution to the metal balance of the escargot may be, if at all, of only marginal significance, but may enclose a major interest in evolutionary studies.

Cantareus aspersus metallothionein metal binding abilities: The unspecific CaCd/CuMT isoform provides hints about the metal preference determinants in metallothioneins

“…CaMTcontaining samples were pooled and stored at − 70°C until further use. Due to the specific recombinant expression conditions, the three synthesized snail MT isoforms contained one additional amino acid residue (Gly) at their N-termini in relation to the native isoforms previously isolated [16]. This modification does not interfere with their metal-binding capacity, as previously shown both for the H. pomatia [16] and mammalian [18] MT isoforms.…”

“…Two of these three isoforms correspond to the paralogs of the well-characterized, metal specific H. pomatia isoforms: the CaCdMT, upregulated by Cd and devoted to Cd detoxification in the midgut gland [29], and the CaCuMT, constitutively expressed in rhogocytes, and involved in internal Cu balance and metabolism, mainly in relation to copper respiratory pigments [16]. The third isoform was natively isolated as a mixed Cd and Cu complex, and for this reason named CaCd/CuMT, but the poor level of expression and the lack of metal response of its encoding gene suggested a residual role, if any, in the snail metabolism of metals, either physiological or xenobiotic.…”

“…In this scenario, we considered of the utmost interest to analyze the metal complexes rendered by the snail MT unspecific isoform, to compare them with those of the Cd-and Cu-specific paralogous MT isoforms, and finally to verify if the Cd/CuMT metal binding abilities were in accordance with its position in the phylogenetic trees. Consequently, we undertook the characterization of the coordination capabilities of the three C. aspersus MT isoforms (CaMTs), for which the three cDNA clones were available [16]. Previous study of the physiological significance of the three CaMTs had confirmed that the two metal specific isoforms behaved similarly to their respective orthologous H. pomatia proteins.…”

“…Previous study of the physiological significance of the three CaMTs had confirmed that the two metal specific isoforms behaved similarly to their respective orthologous H. pomatia proteins. Hence, the gene encoding the C. aspersus Cd-specific isoform (CaCdMT) was found significantly upregulated by cadmium intake and the peptide was shown to be responsible for cadmium accumulation in cadmium-fed snails; while its Cu-specific isoform (CaCuMT) was shown to be essentially unresponsive to metal induction and associated with rhogocyte copper metabolism [16]. The contribution of the unspecific CaCd/CuMT peptide to metal-related functions was hardly noticeable, since its encoding gene did not exhibit any definite metalinduction pattern, and it never led to any significant accumulation of the corresponding metal complexes in snails.…”

“…The C. aspersus coding regions for the three MT isoforms were amplified by PCR using the respective cDNAs synthesized during a previous investigation [16], which were cloned in TOPO TA vectors, as a template (NCBI accession codes: EF152281, EF178297, EF206312). The coding region of each cDNA was PCR-amplified using the following oligonucleotides as primers: (i) for CaCdMT, 5′ TTCACCGCAGGACATCAATC 3′ (upstream) and 5′ CGAAAATCATCAGTCAATCAT 3′ (downstream); (ii) for CaCuMT, 5′ CACCGCAGAGTACGCGGGAATCG 3′ (upstream) and 5′ TACAATGGTACTTAAAACTGAAACC 3′ (downstream); and (iii) for CaCd/CuMT, 5′ ATCCAGCCACAGGACAGACGC 3′ (upstream) and 5′ AGACGATGTAAAGAAATGTGGCAA 3′ (downstream).…”