Polymerase Chain Reaction Amplification of a Repetitive DNA Sequence Specific for Mycobacterium tuberculosis

Abstract

A segment of DNA repeated in the chromosome of Mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (PCR). The sequences of the primers (5' to 3') were CCTGCGAGCGTAGGCGTCGG and CTCGTCCAGCGCCGCTTCGG, and a temperature of 68 degrees C was used for annealing the primers in the reaction. Amplification produced a 123-base-pair fragment with an internal SalI site. The specific PCR product was obtained with input DNA from 11 different strains of M. tuberculosis and Mycobacterium bovis and one strain of Mycobacterium simiae. No product was detected with DNA from 28 strains of the Mycobacterium avium complex, Mycobacterium scrofulaceum, Mycobacterium kansasii, Mycobacterium fortuitum, Mycobacterium chelonei, and Mycobacterium gordonae. The PCR product was detected by gel electrophoresis after 30 cycles using 1 fg of input DNA. Amplification of this sequence may provide the basis for an assay to detect M. tuberculosis directly in clinical material.

Species identification of mycobacteria in paraffin-embedded tissues: frequent detection of nontuberculous mycobacteria

“…It amplifies a sequence of 123 bp of the insertion sequence IS6110 by using a single-step approach (40 cycles). 8 As positive control, we used DNA of M. tuberculosis (H37Rv). The negative controls consisted of template-free reaction mix with deionized water.…”

“…Only some of them are suitable for routine application on formalin-fixed paraffin-embedded material. [5][6][7][8][9][10][11] and only few PCR protocols are able to amplify hypervariable gene regions, necessary for identification of nontuberculous mycobacteria. One of the protocols that fulfills these requirements was published by Cook et al 5 This method amplifies a short fragment (133 bp) of the hypervariable region, that belongs to the 65-kDa heat-shock protein gene (hsp65).…”

Management of presumed intraocular tuberculosis, possible role of the polymerase chain reaction

“…Thus anti-tuberculosis chemotherapy which is prolonged, expensive and toxic, is largely administered empirically for want of a specific diagnostic test based on the demonstration of Mycobacterium tuberculosis in ocular specimens. The polymerase chain reaction (PCR) technique has opened new vistas in microbiologic diagnosis by offering a significant advantage over the traditional methods for identifying Mycobacterium tuberculosis in tiny samples of various body fluids and biopsy specimens (Shanker et al 1990;Eisenach et al 1990;Cousins et al 1992). Particularly in areas where tuberculosis is endemic and positive tuberculin reactions are widespread, PCR could help select patients most likely to benefit from antituberculosis chemotherapy by providing an objective evidence of Mycobacterium tuberculosis infection in patients with ocular inflammation.…”

Spoligotyping andMycobacterium tuberculosis

“…The development of new PCR-based typing methods (4,5,9,10,20–23) has allowed rapid mycobacterial identification to be combined with epidemiologic typing results. Thus, molecular epidemiologic information can be combined in the context of epidemic events and tuberculosis transmission.…”

“…Well-equipped clinical laboratories can detect tuberculosis cases within 14 to 21 days by using liquid culturing systems such as BACTEC (Becton Dickinson, Sparks, MD, USA). Moreover, several studies have verified the usefulness of nucleic acid amplification–based methods for diagnosis of Mycobacterium tuberculosis infections in <24 hours (2–4). Concomitantly, recently characterized molecular markers for typing mycobacterial strains have greatly facilitated and improved the study of tuberculosis epidemiology (5–8).…”