Polymerase Chain Reaction (PCR): Principle and Applications

Abstract

The characterization of the diversity of species living within ecosystems is of major scientific interest to understand the functioning of these ecosystems. It is also becoming a societal issue since it is necessary to implement the conservation or even the restoration of biodiversity. Historically, species have been described and characterized on the basis of morphological criteria, which are closely linked by environmental conditions or which find their limits especially in groups where they are difficult to access, as is the case for many species of microorganisms. The need to understand the molecular mechanisms in species has made the PCR an indispensable tool for understanding the functioning of these biological systems. A number of markers are now available to detect nuclear DNA polymorphisms. In genetic diversity studies, the most frequently used markers are microsatellites. The study of biological complexity is a new frontier that requires high-throughput molecular technology, high speed computer memory, new approaches to data analysis, and the integration of interdisciplinary skills. DOI: http://dx.doi.org/10.5772/intechopen.86491 temperature. At this temperature, the matrix DNA, which serves as matrix during the replication, is denatured: the hydrogen bonds cannot be maintained at a temperature higher than 80°C and the double-stranded DNA is denatured into singlestranded DNA (single-stranded DNA). Polymerase Chain Reaction (PCR): Principle and Applications HybridizationThe second step is hybridization. It is carried out at a temperature generally between 40 and 70°C, called primer hybridization temperature. Decreasing the temperature allows the hydrogen bonds to reform and thus the complementary strands to hybridize. The primers, short single-strand sequences complementary to regions that flank the DNA to be amplified, hybridize more easily than long strand matrix DNA. The higher the hybridization temperature, the more selective the hybridization, the more specific it is.

Prevalence of Malaria with Anaemia and HIV Status in Women of Reproductive Age in Onitsha, Nigeria

“…Polymerase chain reaction of the nucleic acid was conducted described by Karim [19] using one Taq quick-load 2X master mix and a standard buffer (New England Biolabs Inc.). Forward (27F; 5 '-AGAGTTTGATCMTGGCTCAG -3') and reverse (5'-1492R TACGGTTACCTTGTTACGACTT -3,) universal primers were used.…”

Wastewater-Based Epidemiology as an Early Warning System for the Spreading of SARS-CoV-2 and Its Mutations in the Population

“…The reaction mixture also includes thermostable DNA polymerase and four deoxyribonucleoside triphosphates (dNTPs) in a buffer solution. After 20–40 PCR cycles, amplicons of the expected size may be detected by agarose gel electrophoresis and staining with ethidium bromide [ 110 ]. Moreover, the identity of the amplified PCR products can be confirmed by sequencing or by hybridization with internal nucleotide probes [ 109 ].…”

Perancangan primer gen lktB pada Fusobacterium necrophorum untuk analisis PCR

“…PCR yang bertujuan untuk mengamplifikasi DNA terdiri dari tiga tahap. Tahap awal dari proses amplifikasi adalah denaturasi untai DNA, kemudian pasangan primer menempel pada fragmen DNA target (annealing), dan tahap terakhir adalah proses perpanjangan urutan DNA (Kadri, 2020).…”