Polymorphism Rs2421943 of the Insulin-Degrading Enzyme Gene and the Risk of Late-Onset Alzheimer’s Disease

Abstract

Background: Insulin-degrading enzyme (IDE) is a widely distributed Zn2+-binding metalloprotease that cleaves multiple short and medium-sized peptides prone to form β-structures. These include insulin and amyloid-β peptides. Accumulation and fibrillation of amyloid-β peptides leading to the formation of amyloid plaques is a characteristic sign of Alzheimer’s disease (AD) pathology. Objective: The study investigated the rs2421943 single nucleotide polymorphism (SNP) of the IDE gene as a risk factor for MCI (Mild cognitive impairment) and AD. Methods: Two independent groups of 1670 patients and controls were included. The AD group consisted of 595 patients and 400 controls; the MCI group involved 135 patients and 540 matched controls. PCR and restriction fragment length analysis was used for analysis of the rs2421943 polymorphism. Using the miRBase and RNA22 prediction tools in silico indicated that the rs2421943 polymorphism is a potential target for a specific miRNA (hsa-miR-7110-5p). Results: AG and GG genotypes of rs2421943 significantly increased the risk of AD and the AG genotype increased the risk of MCI. It seems G allele both increases the risk of AD and accelerates the transition through the MCI phase. In silico study revealed that rs2421943 is inside the sequence binding miRNA hsa-miR-7110-5p. The polymorphism could affect the rate of IDE pre-RNA (heterogeneous nuclear RNA, hnRNA) processing, resulting in slower translation, lower levels of IDE, deficient removal of amyloid-β fragments and greater risk of and/or accelerated progression of AD. Conclusions: GG and AG genotypes of the single nucleotide polymorphism rs2421943 of insulin degrading enzyme gene increase the risk of AD and MCI.

Association between polymorphism rs2421943 of the insulin‐degrading enzyme and schizophrenia: Preliminary report

“…Polymorphisms within the IDE genomic region have been shown to be associated with an increased risk of T2DM due to the involvement of IDE in the control of systemic insulin levels 14 . Similarly, there is a well‐described association between Alzheimer's disease and IDE based on Aβ clearance, with the G allele of the rs2421943 polymorphism of the IDE gene being associated with an increased risk of Alzheimer's disease and mild cognitive impairment 22 . To date, no studies have specifically investigated the relationship between polymorphisms of the IDE gene and schizophrenia.…”

“…The selected SNP rs2421943 (chr10:92552058), which has a minor allele frequency of 0.44 in the European population, was analyzed using the PCR‐RFLP method. The fragment with analyzed SNP was amplified using previously designed primers 5′‐ TGAGTTATTATTTGATGGGTACAGA‐3′ as a forward (left) primer and 5′‐GTTTGTTAGAATATTGATTGTTTCTGA‐3′ as a reverse (right) primer 22 . The PCR reaction mixture contained 1 μL of DNA template, primers at a concentration of 0.25 μM, and EliZyme HS FAST MIX 2x (Elisabeth Pharmacon, Czech Republic) in a final volume of 20 μL.…”

“…Besides, IDE is specific for β‐sheet substrates, 20 making its proteolytic activity relevant against toxic oligomer formation associated with neurodegenerative diseases such as Alzheimer's disease (AD) and Parkinson's disease (PD). Given that insulin can modulate the clearance of extracellular Ab oligomers by regulating IDE, it represents a key molecular link between AD, PD, and T2DM today 21–23 . However, some recent studies suggest the possible involvement of the IGF‐I pathway in SZ, along with disturbed insulin signaling pathways, and suggest an association of T2DM with SZ in drug‐naïve patients, providing a reason to believe that brain IDE may be involved in SZ 18,24 .…”

The “Cerebrospinal Fluid Sink Therapeutic Strategy” in Alzheimer’s Disease—From Theory to Design of Applied Systems

“…Finally, the insulin-degrading enzyme (IDE) seems to gain significant ground in the understanding of Aβ dynamics. IDE is thought to inhibit Aβ fibrillogenesis, with studies suggesting specific gene polymorphisms to be linked to an increased risk of late-onset AD (LOAD) [ 43 ].…”

Cellular Reprogramming and Its Potential Application in Alzheimer’s Disease

“…Early life stress and environmental neurotoxic may be risk factors for the initiation and progression of LOAD ( Gauvrit et al, 2022 ; Tsamou et al, 2022 ). The GG and AG genotypes of the insulin-degrading enzyme (IDE) gene SNP rs2421943 may affect the rate of IDE pre-RNA (heterogeneous nuclear RNA, hnRNA) processing, resulting in slower translation, reduced IDE levels, insufficient removal of Aβ fragments, and increased risk and/or accelerated progression of AD ( Šerý et al, 2022 ).…”