Prevalence ofbla_NDM,bla_PER,bla_VEB,bla_IMP, andbla_VIMGenes amongAcinetobacter baumanniiIsolated from Two Hospitals of Tehran, Iran

Abstract

Background and Objectives. The aim of this study was to determine the frequency of bla NDM, bla PER, bla VEB, bla IMP, and bla VIM type genes among A. baumannii isolates from hospitalized patients in two hospitals in Tehran, Iran. Patients and Methods. Antibiotic susceptibility tests were performed by Kirby-Bauer disc diffusion and Broth microdilution methods. The frequency of MBL (metallo-beta-lactamase) and ESBL (extended-spectrum-beta-lactamase) producers was evaluated by CDDT. The β -lactamases genes were detected by PCR and sequencing methods. Results. The resistance of A. baumannii isolates against tested antibiotics was as follows: 103 (95.4%) to ceftazidime, 108 (100%) to cefotaxime, 105 (95.7%) to cefepime, 99 (91.7%) to imipenem, 99 (91.7%) to meropenem, 87 (80.6%) to amikacin, 105 (97.2%) to piperacillin, 100 (92.6%) to ciprofloxacin, 103 (95.4%) to piperacillin/tazobactam, 44 (40.7%) to gentamicin, 106 (98.1%) to ampicillin/sulbactam, 106 (98.1%) to co-trimoxazole, 87 (80.6%) to tetracycline, and 1 (1.8%) to colistin. Using combined disk diffusion test, 91 (84.2%) and 86 (86.86%) were ESBL and MBL producers, respectively. The prevalence of bla PER-1, bla VEB-1, bla IMP-1, and bla VIM-1 genes was 71 (78.03%), 36 (39.5%), 3 (3.48%), and 15 (17.44%), respectively. Conclusions. The prevalence of ESBLs and MBLs-producing A. baumannii strains detected in this study is a major concern and highlights the need of infection control measures.

Molecular characterization of carbapenem-resistant <i>Acinetobacter baumannii</i> isolated from pediatric burns patients in an Iranian hospital

“…In a study performed by Fallah et al [22], 17.4 and 3.5 % of A. baumannii isolates were positive for the bla VIM and bla IMP genes, respectively. Yousefi et al [9] showed that bla IMP was more important, especially among the clinical isolates of Pseudomonas aeruginosa in Iran.…”

Limited genetic diversity and extensive antimicrobial resistance in clinical isolates of Acinetobacter baumannii in north-east Iran

“…Shahcheraghi et al (2011) reported A. baumannii SPM producers in Tehran medical centres. Moreover, Fallah et al (2014) and Peymani et al (2011) reported VIM and IMP MBL producers. It should be noted that the rate of VIM producers in Ghaem Hospital (76%) was the highest ever reported in Iran.…”

Phenotypic and Molecular Detection of Metallo-Beta-Lactamase Genes Among Imipenem Resistant Pseudomonas aeruginosa and Acinetobacter baumannii Strains Isolated From Patients with Burn Injuries

“…Infection caused by these bacteria often lead to significant mortality and morbidity (15,20). In the current study, the best coverage against P. aeruginosa isolates was obtained with colistin sulfate and gentamicin.…”

“…and NDM-R(CGGAATGGCTCATCACGATC) (621 bp) for bla NDM (15). Reactions were performed on a thermal cycler (Eppendorf, Master Cycler Gradient) and PCR programs used in 2…”