Processing of the 17‐S <i>Escherichia coli</i> Precursor RNA in the 27‐S Pre‐Ribosomal Particle

Hayes, F. Newton; Vasseur, Marc

doi:10.1111/j.1432-1033.1976.tb10037.x

Cited by 65 publications

(45 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The ribosomal structure apparently alters the conformation of the 5S RNA precursor to allow more rapid and accurate processing than is possible with an isolated RNA molecule. Similar observations have been made by others for various rRNAs with extracts or partially purified enzyme preparations (23)(24)(25)(26), and this seems to be a common theme for rRNA maturation.…”

Section: Discussionsupporting

confidence: 66%

The tRNA processing enzyme RNase T is essential for maturation of 5S RNA.

Deutscher

1995

Proc. Natl. Acad. Sci. U.S.A.

102

View full text Add to dashboard Cite

The maturation of 5S RNA in Escherichia coli is poorly understood. Although it is known that large precursors of 5S RNA accumulate in mutant cells lacking the endoribonuclease RNase E, almost nothing is known about how the mature 5' and 3' termini of these molecules are generated. We have examined 5S RNA Eight exoribonucleases that remove nucleotides in the 3' to 5' direction have been identified in E. coli (8, 9), and mutant strains lacking many of these enzymes, alone or in combination, are available (8, 10, 11). We have used these strains in combination with Northern blot analysis to address the question of whether any of these RNases might participate in the maturation of 5S RNA. Our results indicate that RNase T (12), an enzyme previously shown to participate in tRNA end turnover and tRNA processing (2), is required for maturation of the 3' terminus of 5S RNA. In the absence of RNase T, aThe publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.5S RNA molecule with 2 extra residues at its 3' end accumulates. Interestingly, cells containing this incompletely processed molecule and devoid of mature 5S RNA are nevertheless viable and grow only slightly slower than wild-type cells. MATERIALS AND METHODSBacterial Strains and Plasmids. E. coli K-12 strain CA244 (lacZ, trp, relA, spoT) (11) was considered wild type for these studies. Exoribonuclease-deficient derivatives of CA244 were constructed by P1 transduction as described (10,11,13 RNA Preparation. Cells were grown in YT medium to A550 1. Total RNA was isolated by phenol extraction as described (16). The RNA was used for analysis without further fractionation. rRNA was isolated from the ribosome fraction of cell extracts prepared as described (17). 5S RNA was purified from the total RNA of strain CA244 by gel filtration on Sephadex G-100.RNase T Treatment. Total RNA, 5S RNA, or ribosomes were treated with purified RNase T in 20 mM glycine-NaOH, pH 8.9/10 mM MgCl2/5 mM dithiothreitol. Samples were incubated at 37°C for various times and diluted immediately into ice-cold gel loading buffer containing 25 mM Tris HCl (pH 7.5), 0.5 mM EDTA (pH 8.0), 50% formamide, 0.1% xylene cyanol, and 0.1% bromphenol blue.Northern Blot Analysis. RNA samples, dissolved in gel loading buffer, were loaded on a 5% polyacrylamide/8.3 M urea sequencing gel. The gel was run at 1700 V until the xylene cyanol dye migrated 31 cm. The RNA was transferred to a GeneScreenPlus membrane (DuPont) by electroblotting. The RNA was hybridized with a chemically synthesized 22-mer deoxyoligonucleotide, GTTCGGCATGGGGTCAGGTGGG, complementary to residues 26-47 of 5S RNA, and labeled with 32P at its 5' end. The membrane was prehybridized at 42°C for 30 min in buffer containing 4x SSC, 0.5% SDS, lx Denhardt's solution, and 0.1 mg of denatured salmon sperm DNA per ml. Hybridization was carried out at 42°C overnight in the same buffer containing 0...

show abstract

Section: Discussionsupporting

confidence: 66%

The tRNA processing enzyme RNase T is essential for maturation of 5S RNA.

Deutscher

1995

Proc. Natl. Acad. Sci. U.S.A.

102

View full text Add to dashboard Cite

show abstract

“…The mature RNA sequence or its association with specific proteins has been shown to promote cleavages that form the mature termini of Bacillus subtilis 5S (27) and E. coli 16S rRNAs (14). Consistent with this possibility is the observation that the processing of 45S pre-rRNA in eucaryotic cells occurs after it is completely transcribed and has associated with proteins.…”

Section: Methodssupporting

confidence: 63%

Location of the initial cleavage sites in mouse pre-rRNA.

et al. 1983

View full text Add to dashboard Cite

Small and large subunit rRNAs are cotranscribed in both procaryotic and eucaryotic cells in long precursors which are then processed to produce mature rRNAs (for reviews, see references 1, 12, 25). Since the initial rRNA precursors and mature rRNAs are analogous in all cells, it is reasonable to ask whether the mechanism of processing is also universal.The initial steps in rRNA processing are especially well characterized in E. coli: primary cleavages are made by RNase III at very stable double-stranded stems enclosing large loops containing the 16S or 23S rRNA sequences (8,34). The resultant RNAs bear 7 to 150 extra nucleotides at their termini; the mature 5' and 3' termini are formed by secondary cleavages, which occur after the intermediates have bound ribosomal proteins.Although the mechanisms of mammalian prerRNA processing are largely unknown, previous studies have suggested some differences between the pre-rRNA processing in mammalian cells and Escherichia coli. The spacers flanking the small and large subunit rRNAs in yeast (31), t Present address:

show abstract

“…There have been a series of studies suggesting that the final rRNA processing events occur in polysomes (Mangiarotti et al 1974;Hayes and Vasseur 1976). In contrast, the structure of the immature 30S subunit presented here suggests that processing of the 39 precursor sequence of the 17S rRNA is a prerequisite to the formation of functional 70S ribosomes.…”

Section: Discussionmentioning

confidence: 51%

“…In contrast, the structure of the immature 30S subunit presented here suggests that processing of the 39 precursor sequence of the 17S rRNA is a prerequisite to the formation of functional 70S ribosomes. Unfortunately, the precursor 16S rRNAs used in these early studies (Mangiarotti et al 1974;Hayes and Vasseur 1976) were not fully characterized, and thus, it is unclear which of the precursor sequences were present in these precursor rRNA molecules. More recently, other studies have characterized precursor 16S rRNAs produced in E. coli strains containing mutations in the rne (encoding for RNase E) and rng genes (encoding for RNase G) and the incorporation of these precursor molecules into 70S ribosomes.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Understanding ribosome assembly: the structure of in vivo assembled immature 30S subunits revealed by cryo-electron microscopy

Jomaa¹,

Stewart²,

Martín‐Benito³

et al. 2011

RNA

111

View full text Add to dashboard Cite

Four decades after early in vitro assembly studies demonstrated that ribosome assembly is a controlled process, our understanding of ribosome assembly is still incomplete. Just as structure determination has been so important to understanding ribosome function, so too will it be critical to sorting out the assembly process. Here, we used a viable deletion in the yjeQ gene, a recognized ribosome assembly factor, to isolate and structurally characterize immature 30S subunits assembled in vivo. These small ribosome subunits contained unprocessed 17S rRNA and lacked some late ribosomal proteins. Cryo-electron microscopy reconstructions revealed that the presence of precursor sequences in the rRNA induces a severe distortion in the 39 minor domain of the subunit involved in the decoding of mRNA and interaction with the large ribosome subunit. These findings suggest that rRNA processing events induce key local conformational changes directing the structure toward the mature assembly. We concluded that rRNA processing, folding, and the entry of tertiary r-proteins are interdependent events in the late stages of 30S subunit assembly. In addition, we demonstrate how studies of emerging assembly factors in ribosome biogenesis can help to elucidate the path of subunit assembly in vivo.

show abstract

Processing of the 17‐S Escherichia coli Precursor RNA in the 27‐S Pre‐Ribosomal Particle

Cited by 65 publications

References 23 publications

The tRNA processing enzyme RNase T is essential for maturation of 5S RNA.

The tRNA processing enzyme RNase T is essential for maturation of 5S RNA.

Location of the initial cleavage sites in mouse pre-rRNA.

Understanding ribosome assembly: the structure of in vivo assembled immature 30S subunits revealed by cryo-electron microscopy

Contact Info

Product

Resources

About