Procollagen Lysyl Hydroxylase 2 Expression Is Regulated by an Alternative Downstream Transforming Growth Factor β-1 Activation Mechanism

Gjaltema, Rutger A. F.; Rond, Saskia de; Rots, Marianne G.; Bank, Ruud A.

doi:10.1074/jbc.m114.634311

Cited by 58 publications

(59 citation statements)

References 65 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…It has been reported that LH2 is regulated at the transcriptional level by hypoxia-inducible factor 1α, TGF-β and several profibrotic cytokines, c-Myb, and microRNA-26a/b12133435363738. Our finding that LH2 protein levels were similar between Fkbp10 +/+ and Fkbp10 −/− MEFs indicates that LH2 function is regulated post-translationally by FKBP65.…”

Section: Discussionsupporting

confidence: 68%

FKBP65-dependent peptidyl-prolyl isomerase activity potentiates the lysyl hydroxylase 2-driven collagen cross-link switch

Chen

Terajima

Banerjee

et al. 2017

Sci Rep

View full text Add to dashboard Cite

Bruck Syndrome is a connective tissue disease associated with inactivating mutations in lysyl hydroxylase 2 (LH2/PLOD2) or FK506 binding protein 65 (FKBP65/FKBP10). However, the functional relationship between LH2 and FKBP65 remains unclear. Here, we postulated that peptidyl prolyl isomerase (PPIase) activity of FKBP65 positively modulates LH2 enzymatic activity and is critical for the formation of hydroxylysine-aldehyde derived intermolecular collagen cross-links (HLCCs). To test this hypothesis, we analyzed collagen cross-links in Fkbp10-null and –wild-type murine embryonic fibroblasts. Although LH2 protein levels did not change, FKBP65 deficiency significantly diminished HLCCs and increased the non-hydroxylated lysine-aldehyde–derived collagen cross-links (LCCs), a pattern consistent with loss of LH2 enzymatic activity. The HLCC-to-LCC ratio was rescued in FKBP65-deficient murine embryonic fibroblasts by reconstitution with wild-type but not mutant FKBP65 that lacks intact PPIase domains. Findings from co-immunoprecipitation, protein-fragment complementation, and co-immunofluorescence assays showed that LH2 and FKBP65 are part of a common protein complex. We conclude that FKBP65 regulates LH2-mediated collagen cross-linking. Because LH2 promotes fibrosis and cancer metastasis, our findings suggest that pharmacologic strategies to target FKBP65 and LH2 may have complementary therapeutic activities.

show abstract

Section: Discussionsupporting

confidence: 68%

FKBP65-dependent peptidyl-prolyl isomerase activity potentiates the lysyl hydroxylase 2-driven collagen cross-link switch

Chen

Terajima

Banerjee

et al. 2017

Sci Rep

View full text Add to dashboard Cite

show abstract

“…After 24 h, total RNA was extracted using TRIzol reagent (Invitrogen), and 1 μ g of RNA was converted into cDNA using the ImProm‐II Reverse Transcription System (Promega, Madison, WI, USA). Quantitative real‐time PCR procedures were performed using LightCycler 480 SYBR Green I Master (Roche Diagnostics, Mannheim, Germany), an equal amount of cDNA, and specific primers for genes encoding type I collagen and its modifying enzymes, as follows: collagen type I alpha‐2 chain ( COL1A2 ) , 5′‐TAATGGGGAAGCTGGATCTG‐3′ (forward) and 5′‐GTCCCTGAGCACCATTGTTT‐3′ (reverse); LH1 ( PLOD1 ) , 5′‐GAAGCTCTACCCCGGCTACT‐3′ (forward) and 5′‐CTTGTAGCGGACGACAAAGG‐3′ (reverse); LH2 ( PLOD2 ) , 5′‐GGGAGTTCATTGCACCAGTT‐3′ (forward) and 5′‐GAGGACGAAGAGAACGCTGT‐3′ (reverse); LH3: PLOD3 , 5′‐CACTACGGCCAGTGGTCAG‐3′ (forward) and 5′‐GTGGGCACATTCTCGTAGC‐3′ (reverse); GLT25D1 ( GLT25D1 ) , 5′‐GATGCTGCCTGTGGACGAGTTC‐3′ (forward) and 5′‐CTCACATAGCCATCGTCTCCTG‐3′ (reverse); LOX ( LOX ) , 5′‐CGCTGTGACATTCGCTACACAGGAC‐3′ (forward) and 5′‐CATTGGGAGTTTTGCTTTGCCTTCT‐3′ (reverse); and glyceraldehyde‐3‐phosphate dehydrogenase ( GAPDH ) , 5′‐GCTCTCCAGAACATCATCC‐3′ (forward) and 5′‐GTGTCGCTGTTGAAGTCAG‐3′ (reverse). Results were analyzed using the LightCycler 480 Instrument (Roche Diagnostics).…”

Section: Methodsmentioning

confidence: 99%

Comparative evaluation of periodontal ligament fibroblasts stored in different types of milk: effects on viability and biosynthesis of collagen

Sinpreechanon

Boonzong

Sricholpech

2019

European J Oral Sciences

View full text Add to dashboard Cite

Milk remains one of the most frequently recommended solutions for storage of avulsed teeth because it can maintain cell viability and is easily accessible. However, some negative effects of milk on avulsed teeth have been reported, just as the effects of milk on the long‐term functions of cells are not clear. This study aimed to evaluate the effects of different types of milk on the viability, proliferation, and functions of periodontal ligament fibroblasts (PDLF)s in vitro. Human PDLFs were culture‐medium depleted for 5 min and stored in Hanks’ balanced salt solution (HBSS), whole cow's milk, low‐fat cow's milk, or almond milk for 1 h at 25°C. Cell viability and proliferation were assessed using MTT assays. Expression of the genes encoding type I collagen and its modifying enzymes were analyzed using real‐time PCR. Collagen matrix production was evaluated using Picrosirius red polarization. Our results showed the overall efficiency of low‐fat cow's milk in maintaining the viability and proliferation of PDLFs, and in enhancing the process of collagen production. Almond milk storage resulted in the highest rate of PDLF proliferation, and comparable collagen biosynthesis ability to the control. Therefore, besides low‐fat cow's milk, almond milk may potentially be an alternative tooth‐storage medium for PDLF preservation and PDL tissue regeneration.

show abstract

“…TGFβ1 strongly induces collagen type I and LH2 expression in fibroblasts (45)(46)(47). We performed immunocytochemistry to verify the expression of LH2, FKBP65, and procollagen type Iα1 after TGFβ1 stimulation of primary dermal fibroblasts.…”

Section: Lh2 Splicementioning

confidence: 99%

Disentangling mechanisms involved in collagen pyridinoline cross-linking: The immunophilin FKBP65 is critical for dimerization of lysyl hydroxylase 2

Gjaltema

Stoel

Boersema

et al. 2016

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

View full text Add to dashboard Cite

Collagens are subjected to extensive posttranslational modifications, such as lysine hydroxylation. Bruck syndrome (BS) is a connective tissue disorder characterized at the molecular level by a loss of telopeptide lysine hydroxylation, resulting in reduced collagen pyridinoline cross-linking. BS results from mutations in the genes coding for lysyl hydroxylase (LH) 2 or peptidyl-prolyl cis-trans isomerase (PPIase) FKBP65. Given that the immunophilin FKBP65 does not exhibit LH activity, it is likely that LH2 activity is somehow dependent on FKPB65. In this report, we provide insights regarding the interplay between LH2 and FKBP65. We found that FKBP65 forms complexes with LH2 splice variants LH2A and LH2B but not with LH1 and LH3. Ablating the catalytic activity of FKBP65 or LH2 did not affect complex formation. Both depletion of FKBP65 and inhibition of FKBP65 PPIase activity reduced the dimeric (active) form of LH2 but did not affect the binding of monomeric (inactive) LH2 to procollagen Iα1. Furthermore, we show that LH2A and LH2B cannot form heterodimers with each other but are able to form heterodimers with LH1 and LH3. Collectively, our results indicate that FKBP65 is linked to pyridinoline cross-linking by specifically mediating the dimerization of LH2. Moreover, FKBP65 does not interact with LH1 and LH3, explaining why in BS triple-helical hydroxylysines are not affected. Our results provide a mechanistic link between FKBP65 and the loss of pyridinolines and may hold the key to future treatments for diseases related to collagen cross-linking anomalies, such as fibrosis and cancer.collagen cross-linking | lysyl hydroxylase | FKBP65 | Bruck syndrome | fibrosis C ollagen I is an essential component of the extracellular matrix (ECM) of tissues such as bone and skin, and is involved in a wide variety of biological processes. A deregulated synthesis of collagen type I results in pathologies ranging from severe bone and skin anomalies to fibrosis (1-5). Hydroxylation of specific lysine (Lys) residues into 5-hydroxylysine (Hyl) is performed by lysyl hydroxylases (LHs), also known as the procollagen-lysine, 2-oxoglutarate 5-dioxygenase (PLOD) family. Collagens deposited in the ECM are stabilized by the formation of intermolecular crosslinks by members of the lysyl oxidase family, LOX and LOXL (6). Two collagen cross-linking pathways have been identified, the allysine route and the hydroxyallysine route (7). In the allysine route, a telopeptide Lys is oxidized by lysyl oxidases into an aldehyde; in the hydroxyallysine route, this occurs with a telopeptide Hyl. In turn, the reactive aldehydes interact with the Lys or Hyl residues in the helical part of collagen to form difunctional and finally trifunctional cross-links (8-10). The trifunctional cross-links derived from the hydroxyallysine route are referred to as pyridinolines. Collagens cross-linked by means of pyridinolines are difficult to degrade (11-13).The LH family consists of three individual members, designated LH1, LH2, and LH3. Hydroxylation of Lys present...

show abstract

Procollagen Lysyl Hydroxylase 2 Expression Is Regulated by an Alternative Downstream Transforming Growth Factor β-1 Activation Mechanism

Cited by 58 publications

References 65 publications

FKBP65-dependent peptidyl-prolyl isomerase activity potentiates the lysyl hydroxylase 2-driven collagen cross-link switch

FKBP65-dependent peptidyl-prolyl isomerase activity potentiates the lysyl hydroxylase 2-driven collagen cross-link switch

Comparative evaluation of periodontal ligament fibroblasts stored in different types of milk: effects on viability and biosynthesis of collagen

Disentangling mechanisms involved in collagen pyridinoline cross-linking: The immunophilin FKBP65 is critical for dimerization of lysyl hydroxylase 2

Contact Info

Product

Resources

About