Prolactin restores branchial mitochondrion-rich cells expressing Na⁺/Cl⁻cotransporter in hypophysectomized Mozambique tilapia

Abstract

Hypophysectomy and hormone replacement therapy were conducted to investigate the regulation of branchial mitochondrion-rich cell (MRC) recruitment and hormone receptor expression in euryhaline tilapia (Oreochromis mossambicus). Gene expression and immunolocalization of Na(+)/Cl(-) cotransporter (NCC) and Na(+)/K(+)/2Cl(-) cotransporter (NKCC) were used as markers for freshwater (FW)- and seawater (SW)-type MRCs, respectively. In FW fish, hypophysectomy resulted in a significant drop in plasma osmolality, an effect associated with a marked reduction of NCC gene expression and the disappearance of MRCs with apical-NCC immunoreactivity. In contrast, hypophysectomy in SW fish did not impact plasma osmolality, NKCC, or Na(+), K(+)-ATPase(alpha1) gene expression, or the recruitment of MRCs with basolateral-NKCC. Hypophysectomized fish in SW exhibited reduced mRNA levels of prolactin (PRL) receptor 1 and growth hormone (GH) receptor in the gill; GH receptor expression was also reduced following hypophysectomy in FW. PRL replacement therapy restored NCC gene expression and the appearance of MRCs with apical NCC in both FW and SW; there was no interaction of PRL with cortisol. In FW, cortisol modestly stimulated NKCC mRNA levels, while no effect of GH was evident. In SW, no clear effects of hormone replacement on gene expression of NKCC, Na(+), K(+)-ATPase(alpha1), or hormone receptors were detected. Taken together, the essential nature of PRL to survival of Mozambique tilapia in FW is derived, at least in part, from its ability to stimulate the recruitment of MRCs that express NCC, while recruitment of SW-type MRCs does not require pituitary mediation in this euryhaline tilapia.

Switching of Na+, K+-ATPase isoforms by salinity and prolactin in the gill of a cichlid fish

“…These studies described the expression of either a sodium proton exchanger type 3 (nhe3) or a sodium chloride cotransporter (ncc) in two distinct FW-type MRCs. In accordance with their activity to support Cl K uptake in hypoosmotic environments (Horng et al 2009), Ncc-expressing MRCs are stimulated by oPrl injection (Breves et al 2010b). The drop in Na C , K C -ATPase a-1a mRNA during SW acclimation observed in this study correlates well with decreased ncc and nhe3 mRNA expression reported for larval and adult tilapia transferred to SW , Breves et al 2010a.…”

“…Primer sequences were tested for nonspecific product amplification and primer-dimer formation by melting curve analysis; amplicon size was verified by agarose gel electrophoresis. Elongation factor 1a (ef-1a) primers have previously been reported (Breves et al 2010b). Additional primers used were (5 0 -3 0 ): b-actin (forward, CTCTT-CCAGCCTTCCTTCCT; reverse, ACAGGTCCTTACG-GATGTCG; amplicon sizeZ100 nt), acidic ribosomal phosphoprotein p0 (rplp0; forward, CCCCTTGTGATGT-GACAGTG; reverse, GTGATACCCAGAGCCTGGAA; amplicon sizeZ82 nt), Na…”

Prolactin177, prolactin188 and prolactin receptor 2 in the pituitary of the euryhaline tilapia, Oreochromis mossambicus, are differentially osmosensitive

“…Expression of branchial prlr1 decreases with transfer from FW to SW (Breves et al 2010a) and increases with transfer from SW to FW (Breves et al 2011). Furthermore, branchial prlr1 levels decrease after hypophysectomy in SW but not in FW, suggesting that prlr1 expression is regulated, at least in part, by the pituitary (Breves et al 2010b). We found prlr1 in the RPD to be unresponsive either to salinity transfers in vivo or to changes in extracellular osmolality in vitro.…”

“…All primer pairs are previously described: prlr1 (Pierce et al 2007), prlr2 (long isoform; Breves et al 2010b), ostf1 (Breves et al 2010a), prl 177 and prl 188 (Magdeldin et al 2007) and ef1-a (Breves et al 2010b). The quantitative real-time PCRs were set up as previously described (Pierce et al 2007).…”

Angiotensin-II promotes Na+ uptake in larval zebrafish, Danio rerio, in acidic and ion-poor water

“…The molecular mechanisms underlying the active absorption of Na C , Cl K , and Ca 2C have been investigated extensively over the past 80 years (for recent reviews see Evans (2011), Hwang et al (2011), Dymowska et al (2012) and Kumai & Perry (2012)). Based on these previous studies, it is clear that ion uptake is tightly regulated by several hormones, including prolactin (Pickford & Phillips 1959, Breves et al 2010, cortisol (Laurent & Perry 1990, Kumai et al 2012a, stanniocalcin ), vitamin D (Lin et al 2012 and isotocin (Chou et al 2011), as well as being under neurohumoral control (Perry et al 1984, Kumai et al 2012b. The existence of multiple hormonal regulators of ionic regulation highlights the importance of body fluid ionic homeostasis.…”