Protective Effects of Intranasal Immunization with Recombinant Glycoprotein D in Pregnant BALB/c Mice Challenged with Different Strains of Equine Herpesvirus 1

Fuentealba, Nadia Analía; Zanuzzi, Carolina Natalia; Scrochi, Mariela Rita; Sguazza, Guillermo Hernán; Bravi, María Emilia; Paz, V. Cid de la; Corva, Santiago Gerardo; Portiansky, Enrique Leo; Gimeno, Eduardo Juan; Barbeito, Claudio Gustavo; Galosi, Cecília Mônica

doi:10.1016/j.jcpa.2014.06.003

Cited by 7 publications

(6 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…No viral DNA was detected at 7 to 11days PI. Mouse tissues collected from control animals didn't show any DNA PCR product, and they were negative for EHV-1 (Table, 2 In mice inoculated with male donkey samples, the virus followed the same sequence of antigen fate reported by many authors (14)(15)(16). This finding might indicate that the infection of such donkey has recently occurred or might be related to reactivation of the virus from past infection.…”

Section: Resultssupporting

confidence: 55%

See 1 more Smart Citation

Molecular detection of equine herpes virus-1 in local horses (Equus feruscaballus) and donkeys (Equus asinus

Al-Ajeeli¹

2018

Iraqijvm

View full text Add to dashboard Cite

SummaryEquine herpsvirus type1 was classified as a member of the subfamily Alphaherpesvirinae. It was reported to cause respiratory, reproductive and neurologic infection in horses. The reproductive form of the disease induces abortion in pregnant mare, while the neurologic form is associated with paralysis of infected horses. This study was designed for molecular detection of Equine herpsvirus type1 by polymerase chain reaction. Blood buffy coat samples were collected from 25 horses (Equus feruscaballus) and 25 donkeys (Equus asinus) admitted to local private veterinary clinics around Baghdad and Baaquba cities. DNA was extracted from such samples by the use of DNA extraction kit of COLLECTAGENE T .The samples were subjected to conventional PCR test using specific primers for gB gene of equine herepesvirus-1. Forward primer (F) (5' TAACTGAGATCT AACCGAC 3') and reverse primer (R) (CATATATAGCTATCACGTCC 3'). One buffy coat sample from aborted mare and one buffy coat sample from a donkey suffering from acute respiratory clinical signs were inoculated in mice to follow the fate of equine herepesvirus-1in nasal turbinates, cervical lymph nodes and lungs of these mice. The results showed that only 4 samples from horses and 2 samples from donkeys were positive to polymerase chain reaction. Experimentally infected mice did not show any clinical signs but they were positive to polymerase chain reaction, and the virus easily terminated, probably due to low dose of the virus and host specificity. It can be concluded that local horses and donkeys, somewhere have had infected with equine herepesvirus-1, and became latent carriers for the virus. Furthermore, microbiological and epidemiological studies on local Equine herpsvirus type1 and Equine herpsvirus type 4 are recommended.

show abstract

Section: Resultssupporting

confidence: 55%

“…Thus these cells become important reservoirs for persistent viral infection (12 and 13). Mice were used as a potential animal model in experimental infections for this virus by many workers (14)(15)(16). Experimentally infected mice with EHV-1 produced clinical signs, like respiratory distress and weight loss (16 and 17).…”

Section: Introductionmentioning

confidence: 99%

Molecular detection of equine herpes virus-1 in local horses (Equus feruscaballus) and donkeys (Equus asinus

Al-Ajeeli¹

2018

Iraqijvm

View full text Add to dashboard Cite

show abstract

“…Intranasal administration of purified recombinant gD induced partial or complete protection against three different EHV-1 strains (AR11, AR52, and HH1) in BALB/c mice (76). Levels of the IFN-␥ gene and 16 antiviral ISGs were significantly upregulated upon pathogenic RacL11 challenge ( Table 3), suggesting that immunization with attenuated EHV-1 KyA induces innate immune responses upon pathogenic EHV-1 challenge within 2 weeks postimmunization that protect mice.…”

Section: Discussionmentioning

confidence: 99%

Immunization with Attenuated Equine Herpesvirus 1 Strain KyA Induces Innate Immune Responses That Protect Mice from Lethal Challenge

Kim

Shakya

O’Callaghan

2016

J Virol

View full text Add to dashboard Cite

Equine herpesvirus 1 (EHV-1) is a major pathogen affecting equines worldwide. The virus causes respiratory disease, abortion, and, in some cases, neurological disease. EHV-1 strain KyA is attenuated in the mouse and equine, whereas wild-type strain RacL11 induces severe inflammation of the lung, causing infected mice to succumb at 4 to 6 days postinfection. Our previous results showed that KyA Equine herpesvirus 1 (EHV-1), a member of the family Herpesviridae and the subfamily Alphaherpesvirinae, is the causative agent of a number of equine pathological states, including severe disease of the central nervous system, respiratory infections, and abortion storms (1-4). Respiratory transmission of this highly contagious virus has resulted in disastrous outbreaks of disease in domestic horse populations and has had significant economic impact on the equine industry. EHV-1 infection of the horse generates a short-lived humoral response but does not confer long-term protection, since disease often occurs following natural infection (5, 6).A model that closely mimics EHV-1 infection in the natural host has been established with various strains of mice (7). Common features include replication in the respiratory mucosae, the development of pneumonitis, cell-associated viremia, and abortion (7,8). Various EHV-1 glycoproteins, including gB, gC, gD, and gH, were capable of inducing neutralizing antibodies (9-14). EHV-1-specific CD8 ϩ class I major histocompatibility complex (MHC)-restricted cytotoxic T lymphocytes (CTL) were identified in the peripheral blood mononuclear cells of infected horses, reaching maximal levels 2 to 3 weeks postinfection (15,16). Intranasal inoculation of mice with an attenuated EHV-1 strain, KyA, resulted in the production of a primary virus-specific CTL response in the draining mediastinal lymph nodes (17). In this model, EHV-1-specific CTL activity was mediated by class I MHC-restricted CD8 ϩ T cells (17). The nonpathogenic EHV-1 strain Kentucky A (KyA) is attenuated in mice and horses, whereas the wild-type pathogenic strain RacL11 induces severe inflammatory cell infiltration in the lung, such that infected mice succumb at 4 to 6 days postinfection (dpi) (Fig. 1) (18-23). RacL11 was isolated from an aborted fetus (24). KyA has a long history of passage outside the natural host and

show abstract

“…VC2-EHV-1-gD stimulated strong virus-neutralizing (VN) activity in comparison to that seen in both unvaccinated and VC2-vaccinated animals, and this VN activity was similar to that generated by the commercial EHV-1 killed virus vaccine. It has been reported that intranasal or intramuscular immunization with EHV-1 gD produces antigen-specific IgG responses (3,4,8,10,11,(22)(23)(24)(25). In addition, the presence of VN antibody prior to EHV-1 infection was shown to be associated with a reduction in the amount and duration of nasopharyngeal virus shedding (26,27).…”

Section: Figmentioning

confidence: 99%

“…EHV-1 glycoproteins facilitate multiple aspects of the viral life cycle, including mediation of the fusion of the viral envelope with cellular membranes, intracellular virion morphogenesis, egress, cell-to-cell spread, and virus-induced cell fusion. Thus, these proteins are major antigenic determinants for both humoral and cellular immune responses and have been utilized as subunit vaccines (2)(3)(4). Specifically, immunization with EHV-1 glycoprotein D (gD) has been shown to generate protective immune responses in mice and horses (3,(5)(6)(7)(8)(9)(10)(11).…”

mentioning

confidence: 99%

Intramuscular Immunization of Mice with the Live-Attenuated Herpes Simplex Virus 1 Vaccine Strain VC2 Expressing Equine Herpesvirus 1 (EHV-1) Glycoprotein D Generates Anti-EHV-1 Immune Responses in Mice

Liu

Stanfield

Chouljenko

et al. 2017

J Virol

View full text Add to dashboard Cite

Vaccination remains the best option to combat equine herpesvirus 1 (EHV-1) infection, and several different strategies of vaccination have been investigated and developed over the past few decades. Herein, we report that the liveattenuated herpes simplex virus 1 (HSV-1) VC2 vaccine strain, which has been shown to be unable to enter into neurons and establish latency in mice, can be utilized as a vector for the heterologous expression of EHV-1 glycoprotein D (gD) and that the intramuscular immunization of mice results in strong antiviral humoral and cellular immune responses. The VC2-EHV-1-gD recombinant virus was constructed by inserting an EHV-1 gD expression cassette under the control of the cytomegalovirus immediate early promoter into the VC2 vector in place of the HSV-1 thymidine kinase (UL23) gene. The vaccines were introduced into mice through intramuscular injection. Vaccination with both the VC2-EHV-1-gD vaccine and the commercially available vaccine Vetera EHV XP 1/4 (Vetera; Boehringer Ingelheim Vetmedica) resulted in the production of neutralizing antibodies, the levels of which were significantly higher in comparison to those in VC2-and mock-vaccinated animals (P Ͻ 0.01 or P Ͻ 0.001). Analysis of EHV-1-reactive IgG subtypes demonstrated that vaccination with the VC2-EHV-1-gD vaccine stimulated robust IgG1 and IgG2a antibodies after three vaccinations (P Ͻ 0.001). Interestingly, Vetera-vaccinated mice produced significantly higher levels of IgM than mice in the other groups before and after challenge (P Ͻ 0.01 or P Ͻ 0.05). Vaccination with VC2-EHV-1-gD stimulated strong cellular immune responses, characterized by the upregulation of both interferonand tumor necrosis factor-positive CD4 ϩ T cells and CD8 ϩ T cells. Overall, the data suggest that the HSV-1 VC2 vaccine strain may be used as a viral vector for the vaccination of horses as well as, potentially, for the vaccination of other economically important animals.IMPORTANCE A novel virus-vectored VC2-EHV-1-gD vaccine was constructed using the live-attenuated HSV-1 VC2 vaccine strain. This vaccine stimulated strong humoral and cellular immune responses in mice, suggesting that it could protect horses against EHV-1 infection.KEYWORDS EHV-1, HSV-1, equine herpesvirus, live vector vaccines, glycoprotein D, immune response, mouse model

show abstract

Protective Effects of Intranasal Immunization with Recombinant Glycoprotein D in Pregnant BALB/c Mice Challenged with Different Strains of Equine Herpesvirus 1

Cited by 7 publications

References 37 publications

Molecular detection of equine herpes virus-1 in local horses (Equus feruscaballus) and donkeys (Equus asinus

Molecular detection of equine herpes virus-1 in local horses (Equus feruscaballus) and donkeys (Equus asinus

Immunization with Attenuated Equine Herpesvirus 1 Strain KyA Induces Innate Immune Responses That Protect Mice from Lethal Challenge

Intramuscular Immunization of Mice with the Live-Attenuated Herpes Simplex Virus 1 Vaccine Strain VC2 Expressing Equine Herpesvirus 1 (EHV-1) Glycoprotein D Generates Anti-EHV-1 Immune Responses in Mice

Contact Info

Product

Resources

About