Pulsatile Secretion of Gonadotropin-Releasing Hormone by Rat Hypothalamic Explants of GnRH Neurons without Cell Bodies

Abstract

Gonadotropin-releasing hormone (GnRH) is typically secreted in a pulsatile manner. It is still unclear whether pulsatility depends on a GnRH pulse generator residing in the GnRH neurons or in other neurons. Since the cell bodies of GnRH neurons are located rostrally to the optic chiasm and the majority of GnRH terminals in the median eminence of the rat hypothalamus, we have compared GnRH secretion from individual preoptic, retrochiasmatic and median eminence explants using a static incubation system. GnRH is released from the three different types of explant in response to depolarization with veratridine or glutamate receptor stimulation using the agonist N-methyl-D-aspartate. Only the retrochiasmatic explants, however, show a characteristic pulsatile secretion of GnRH. The mean (±SD) interpulse interval is respectively 37 ± 5, 25 ± 4 and 12 ± 1 min when the fractions are collected at 7.5-, 5.0- and 2.5-min intervals. The immunocytochemically stained GnRH cell bodies are normally distributed in the preoptic explants (n = 212–420) while only 3 GnRH cell bodies can be visualized in 7 retrochiasmatic explants. Semi-quantitative RT-PCR shows that GnRH mRNA is present in the retrochiasmatic explant in a ratio of about 1:600 relative to the preoptic explant. We conclude that pulsatile GnRH secretion occurs in the virtual absence of GnRH cell bodies but does not occur from GnRH terminals in the isolated median eminence. These data further indicate that a mechanism of GnRH pulsatility is located in the retrochiasmatic hypothalamus and involves neurons different from the GnRH neurons.

Activation of Gene Expression of the γ-Aminobutyric Acid Rather than the Glutamatergic System in the Preoptic Area during the Preovulatory Gonadotropin Surge of the Rat

“…Using pharmacological approaches in particular the group of Kimura [54, 55]emphasized the importance of the MBH suggesting that GnRH release is controlled at the levels of the nerve terminals. In vitro perfusion studies with hypothalamic fragments containing no GnRH perikarya showed a clear pulsatile GnRH release while those fragments with intact GnRH neurons did not [56, 57]. Furthermore, in the female, prepubertal monkey, infusion of an antisense oligonucleotide construct against GAD67 into the median eminence reduced GABA release [58].…”

Estrogen, Menopause, and the Aging Brain: How Basic Neuroscience Can Inform Hormone Therapy in Women

“…1). GnRH secretion from the median eminence is regulated by NMDAR agonists even when the GnRH perikarya are not present (Purnelle et al, 1997;Kawakami et al, 1998b), suggesting a direct site of action on GnRH terminals. One laboratory demonstrated that GnRH terminals express NMDARs (Kawakami et al, 1998a).…”

Thymic expression of insulin-related genes in an animal model of autoimmune type 1 diabetes

“…The newly synthesized cDNAs were denatured at 94uC for 3 min and amplified by 30 PCR cycles at 94uC for 90 s, annealed for 90 s at the indicated temperature (55uC for IGF-1, 54uC for IGF-2, 57uC for insulin and 54uC for actin), 72uC for 90 s, followed by 72uC for 10 min. The sequences of oligonucleotide primers were as follows: Igf1 (upstream: ATCTCTTCTACCTGGCAGTC, downstream: TACATCTC CAGCCTCCTCAG); Igf2 (upstream: CACGCTTCAGTTTGT CTGTT, downstream: CGGGGTCTTTGGGTGGTAAC); Ins (upstream: ATGGC CCTGTGGATGCGCTTC, downstream: GTTGCAGTAGTTCTCCAGTTG; these primers amplify transcripts from both Ins1 and Ins2 genes) [22]; b actin (upstream: GATGGTGGGTATGGGTCAGAAGGA, downstream: GCTCATTGCCGATAG TGATGACCT) [23]. To exclude the possibility of amplifying genomic DNA, primers were chosen in different exons of IGF genes.…”