Pyrethroid Insecticide Resistance <i>kdr</i> Gene in the House Fly, <i>Musca domestica</i> (Diptera: Muscidae), in the United Arab Emirates

Abstract

The house fly, Musca domestica L., is a very important insect because of its role as a vector of several human, livestock, and poultry diseases. Different groups of insecticides, including the pyrethroids, are used to control house flies. The objective of the current study was to conduct a survey of the kdr insecticide resistance gene in the house fly population in the United Arab Emirates (UAE). Flies were collected from five locations (Abu Dhabi, Dubai, Fujairah, Ajman, and Ras AlKhaymah). Genomic DNA was extracted and polymerase chain reaction (PCR) amplification of specific allele (PASA) was performed. The maximum percentage (70%) of homozygous genotype (kdr/kdr) occurred at Ajman, followed by Dubai (59.5%), and the minimum percentage occurred at Ras Al-Khaymah (14.3%). Resistant insects of the genotype kdr/kdr were detected in all of the tested house fly populations. Ajman and Fujairah house fly populations were in Hardy-Weinberg equilibrium. The resistance kdr allele was found at a high frequency (0.54 -0.8) at all locations except at Ras Al-Khaymah (0.21). Together, this study demonstrated that the pyrethroid insecticide resistance kdr allele was found in UAE house fly populations, strongly suggesting that a countrywide pyrethroid insecticide resistance management program needs to be implemented.

Molecular identification of allelic genotypes of pyrethroid-insecticide resistance in housefly, Iraq

“…If there is no exposure to insecticides, there is no development of resistance to these chemicals by house flies, and this fact supports our results. Table 1 identifies some studied regions in the world with different ratios of tested allelic variations of the para gene regarding the presence of the kdr or the sus genotypes (14,15) in which (15) agree with our result of no presence of the kdr-based allelic variations in all of their samples. However, Authors from China (15) indicate that there were 45.5%, 36%, and 23.9% of the kdr/kdr, kdr/sus, and sus/sus respectively.…”

“…However, Authors from China (15) indicate that there were 45.5%, 36%, and 23.9% of the kdr/kdr, kdr/sus, and sus/sus respectively. In addition, a researcher from United Emirates (14) detected that ratios of kdr/kdr, kdr/sus, and sus/sus were 45.9%, 19.7%, and 39.3 respectively. The presence of the kdr/kdr and kdr/sus genotypes was explained via the frequent use of ineffective insecticides in these countries mentioned in the literature cited above (14,15).…”

“…In addition, a researcher from United Emirates (14) detected that ratios of kdr/kdr, kdr/sus, and sus/sus were 45.9%, 19.7%, and 39.3 respectively. The presence of the kdr/kdr and kdr/sus genotypes was explained via the frequent use of ineffective insecticides in these countries mentioned in the literature cited above (14,15). Because Iraq has no mass insecticideusing programs by responsible officials or by the local people in the governorate, house flies collected in our study had 0% presence of the kdr/kdr and/or kdr/sus.…”

“…The allelic-kdr mutations in the para gene were used to detect the genotypes of pyrethroid resistance in house flies, and the protocol for such analyses was adopted from (14). Two-specific primers of the outer allele, kdr1: AAGGATCGCTTCAAGG and kdr4: TTCACCCAGTTCTTAAAACGAG, were used to generate a 480bp-piece amplification as a house fly-recognition control.…”

Evaluación de la tolerancia y susceptibilidad a insecticidas convencionales y biorracionales en <i>Chrysoperla externa</i> y <i>C. asoralis</i> (Neuroptera: Chrysopidae)

“…arabiensis Patton y Aedes aegypti L.), moscas (Musca domestica L.) y cucarachas (Blattella germanica L.) (Osborne & Smallcombe 2013;Al-Deeb 2014;Gholizadeh et al 2014;Ndiath et al 2014;Pang et al 2015).…”