Quantitation of rabbit cytokine mRNA by real-time RT-PCR

Godornes, Charmie; Leader, Brandon T.; Molini, Barbara J.; Centurión-Lara, Arturo; Lukehart, Sheila A.

doi:10.1016/j.cyto.2007.04.002

Cited by 112 publications

(70 citation statements)

References 25 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Quantitative RT-PCR was performed with SYBR mix (Takara) using ten-fold diluted cDNA from BDMs as template. Specific primers for amplification of IL-4, IL-10, IFN-γ, IL-6, TNF-α, IL-1β and RAGE were described previously [18,19]. In the case of MR, amplification primers were designed based on rabbit sequences available at NCBI Genbank (NC_013684.1) being primer forward 5ʹAAATGTTGAATTTTGTGGTGAGCTA3ʹ and reverse 5ʹTGGCAAATCCAGTTGTTAAGGTGTT3ʹ.…”

Section: Methodsmentioning

confidence: 99%

Lentinula edodes β-glucan enriched diet induces pro- and anti-inflammatory macrophages in rabbit

Crespo

Guillén²,

Pablo-Maiso

et al. 2017

Food & Nutrition Research

View full text Add to dashboard Cite

ABSTRACTβ-glucans exhibited in cell walls of several pathogens as bacteria or fungi are sensed by pathogen recognition receptors such as scavenger receptors present in antigen presenting cells, i.e., macrophages. β-glucans obtained from Shiitake mushrooms were chemically characterized. A β-glucan supplemented diet was assayed for 30 days in rabbits aiming to characterize the immune response elicited in blood-derived macrophages. M1 and M2 profiles of macrophage differentiation were confirmed in rabbits by in vitro stimulation with IFN-γ and IL-4 and marker quantification of each differentiation pathway. Blood derived macrophages from rabbits administered in vivo with the β-glucan supplemented diet showed higher IL-4, IFN-γ and RAGE together with lower IL-10 relative expression, indicative of an ongoing immune response. Differences in IL-1β, IL-13 and IL-4 expression were also found in rabbit sera by ELISA suggesting further stimulation of the adaptive response. Recent challenges in the rabbit industry include the search of diet supplements able to elicit an immune stimulation with particular interest in facing pathogens such as viruses or bacteria. β–glucans from fungi may contribute to maintain an immune steady state favouring protection and thus reducing antibiotic treatment.

show abstract

Section: Methodsmentioning

confidence: 99%

Lentinula edodes β-glucan enriched diet induces pro- and anti-inflammatory macrophages in rabbit

Crespo

Guillén²,

Pablo-Maiso

et al. 2017

Food & Nutrition Research

View full text Add to dashboard Cite

show abstract

“…pallidum replicates at the site of initial inoculation, dividing once every 30-33 hours (14,15), inducing a local inflammatory response that results in a painless chancre approximately 3-6 weeks after initial infection. In each chancre, proliferating spirochetes are surrounded by immune cells, including CD4 + and CD8 + T cells, plasma cells, and macrophages, which produce IL-2 and IFN-γ cytokines, indicating a Th1-skewed response (16)(17)(18)(19)(20)(21). Tissue necrosis and ulceration occur due to small vessel vasculitis, and trafficking immune cells cause a non-tender regional lymphadenopathy.…”

Section: The Natural History Of Syphilis Primary Syphilis -Transmissimentioning

confidence: 99%

Syphilis: using modern approaches to understand an old disease

Lukehart²

2011

J. Clin. Invest.

Self Cite

205

168

View full text Add to dashboard Cite

Syphilis is a fascinating and perplexing infection, with protean clinical manifestations and both diagnostic and management ambiguities. Treponema pallidum subsp. pallidum, the agent of syphilis, is challenging to study in part because it cannot be cultured or genetically manipulated. Here, we review recent progress in the application of modern molecular techniques to understanding the biological basis of this multistage disease and to the development of new tools for diagnosis, for predicting efficacy of treatment with alternative antibiotics, and for studying the transmission of infection through population networks.

show abstract

“…Primers for IL-1 and -2 were designed using the Primer3 Programme (Rozen and Skaletsky 1999) and the available GenBank sequences. For IFN-γ, primers reported by Godornes et al (2007) were used. The mixture was the following: 2 μl cDNA solution, 5 μl 10 × DreamTaq Buffer, 2 μl of 25 pmol/μl of each primer, 1 μl of 1 mmol dNTP Set (Fermentas), 2.5 μl EVA Green (Biotium, USA) and 0.2 DreamTaq TM DNA Polymerase, 5 U/μl DreamTaq TM DNA Polymerase (5 U/μl, Fermentas, USA) at a final volume of 20 μl.…”

Section: Determination Of Immunity Indicatorsmentioning

confidence: 99%

Subchronic exposure to deoxynivalenol exerts slight effect on the immune system and liver morphology of growing rabbits

et al. 2017

View full text Add to dashboard Cite

As the most common grain contaminant worldwide, deoxynivalenol is of high importance despite its low toxicity compared to other trichothecene mycotoxins. Data on the effects of deoxynivalenol in rabbits are scarce. Thus, the aim of this study was to investigate the effects of dietary deoxynivalenol fed at a high level (10 mg/kg of feed) on the productive performance, blood indices, immunological variables, histopathological changes, and genotoxicity in rabbits. Forty-eight Pannon White rabbits were exposed to contaminated diets for three weeks. Despite its high concentration, deoxynivalenol did not affect the feed intake, body weight, and body weight gain. Liver and kidney function was not affected, as shown by the clinical chemistry indices. Conversely, in two rabbits the toxin caused mild fibrosis of the liver, without degenerative changes of the hepatocytes. No genotoxicity could be observed either. Gut cytokines and the phagocytic activity of the macrophages did not differ significantly. The percentage of neutrophils was significantly lower, whereas that of eosinophils was significantly higher in the toxin-fed group. Deoxynivalenol did not cause significant changes in gut and villus morphology. In 4 out of the 6 deoxynivalenol-treated animals, the ratio of lymphoblast proliferation and simultaneous apoptosis shifted towards apoptosis in the gut-associated lymphoid tissue. In the central part of the lymphoid follicles of the spleen, lymphocyte depletion and follicular atrophy could be detected. It can be concluded that rabbits are less sensitive to deoxynivalenol, but the findings confirm that this Fusarium toxin is capable of modulating the immune response. Mycotoxin, immune response, histology, blood indicesMycotoxins are secondary metabolites of filamentous fungi occurring worldwide. Despite being the least toxic trichothecene, the ubiquitous occurrence of deoxynivalenol (DON) in grains increases its importance for food and feed safety. The pig is the most sensitive, whereas ruminants are the least sensitive animal species to DON (Pestka and Smolinski 2005;Pestka 2007;Sobrova et al. 2010). Monogastric animals are extremely prone to growth and body weight gain suppression upon DON exposure. Deoxynivalenol possesses immunomodulatory properties as well (Pestka and Smolinski 2005). To the best of our knowledge, only few experiments have been conducted with DON in rabbits (Khera et al. 1986;Hewitt et al. 2012). The aim of this study, therefore, was to investigate the effects of 10 ppm (mg/kg feed) of dietary DON which is twice as much as the highest guidance value

show abstract

Quantitation of rabbit cytokine mRNA by real-time RT-PCR

Cited by 112 publications

References 25 publications

Lentinula edodes β-glucan enriched diet induces pro- and anti-inflammatory macrophages in rabbit

Lentinula edodes β-glucan enriched diet induces pro- and anti-inflammatory macrophages in rabbit

Syphilis: using modern approaches to understand an old disease

Subchronic exposure to deoxynivalenol exerts slight effect on the immune system and liver morphology of growing rabbits

Contact Info

Product

Resources

About