Radiation hybrid mapping of the zebrafish genome

Abstract

The zebrafish is an excellent genetic system for the study of vertebrate development and disease. In an effort to provide a rapid and robust tool for zebrafish gene mapping, a panel of radiation hybrids (RH) was produced by fusion of irradiated zebrafish AB9 cells with mouse B78 cells. The overall retention of zebrafish sequences in the 93 RH cell lines that constitute the LN54 panel is 22%. Characterization of the LN54 panel with 849 simple sequence length polymorphism markers, 84 cloned genes and 122 expressed sequence tags allowed the production of an RH map whose total size was 11,501 centiRays. From this value, we estimated the average breakpoint frequency of the LN54 RH panel to correspond to 1 centiRay ‫؍‬ 148 kilobase. Placement of a group of 235 unbiased markers on the RH map suggests that the map generated for the LN54 panel, at present, covers 88% of the zebrafish genome. Comparison of marker positions in RH and meiotic maps indicated a 96% concordance. Mapping expressed sequence tags and cloned genes by using the LN54 panel should prove to be a valuable method for the identification of candidate genes for specific mutations in zebrafish.Somatic-cell hybrids and radiation hybrids (RHs) have played a key role in the mapping of human and mouse genes (1-7). Cell hybrids constitute one of the most expedient methods for assigning genes to chromosomes or chromosome segments, because mapping with cell hybrids does not require gene polymorphism. RHs are generated by irradiating cells from a donor species, causing random chromosomal breaks, and fusing these to a cell line from a different species. Donor-cell chromosome fragments are retained to different extents in the ensuing hybrid cells. Typing a panel of RHs with PCR-based sequence-tagged sites creates an RH map in which the frequency of breakpoints between two markers is proportional to the distance between them.The large collection of mutations produced in the zebrafish constitutes a valuable resource for the study of vertebrate developmental mechanisms (8-10). The efficient identification of the genes disrupted by mutation in zebrafish requires dense maps of the genome. Meiotic maps based on rapidamplified polymorphic DNA sequences and microsatellite markers have been produced (11-16). Since localization of cDNAs and expressed sequence tags (ESTs) on meiotic maps requires the identification of polymorphisms, the use of RH mapping is a valuable complementary method suitable for high-throughput cDNA/EST mapping projects to identify candidate genes for available mutants.We have previously shown that stable transfer of zebrafish chromosomes or chromosome segments to a rodent cell line was possible (17). Markers from the simple sequence-length polymorphism (SSLP) meiotic map could be anchored on a panel of zebrafish/mouse somatic-cell hybrids (14). Furthermore, Kwok et al. (18) demonstrated that RH technology could be used for nonmammalian vertebrates. In the present study, we report characterization of LN54, a zebrafish RH panel composed of 93 cell...

Gene Duplications and Evolution of Vertebrate Voltage-Gated Sodium Channels

“…The chromosomal locations of D. rerio scna genes were determined using the LN54 radiation hybrid panel (Hukriede et al 1999) that was generously provided by M. Ekker (Ottawa Health Research Institute, Canada). PCR was performed with gene specific primers designed to amplify an ~200 bp region contained within a single exon.…”

Six cadm/synCAM genes are expressed in the nervous system of developing zebrafish

“…The zebrafish cadm genes were mapped on the LN54 radiation hybrid mapping panel (Hukriede et al, 1999) as described (Postlethwait, 2000). The chromosomal position of each gene was determined through the use of the mapping program of Dr.…”

Zebrafish frizzled‐2 morphant displays defects in body axis elongation

“…Full zebrafish frizzled-2 cDNA sequence has been submitted to the GenBank under accession number AY033592. For radiation hybrid mapping, the radiation hybrid panel LN54, kindly provided by M. Ekker (Hukriede et al, 1999), was screened using fz2 primers CAGTTCTGGGTGACGGACAC and ATTGCACACAACCTTGTCCC. PCR was performed for 26 cycles with annealing temperature of 60 o C. The positives were in groups 8,11,13,16,36,49,59,65,66,70,74,80,84,87,121,138,301,306,309,310,311,312, AB9, and Mix.…”

“…1a, b). Radiation hybrid mapping using panel LN54 (Hukriede et al, 1999) places fz2 on linkage group 3, linked to the marker Z22516 (distance 0.00cR, LOD score 22.2).…”

“…Zebrafish fz2 maps to the marker Z22516, which is located between the hoxb9a and dlx8 genes on linkage group 3 in the LN54 panel (Hukriede et al, 1999; marker list at http://zfin.org/ZFIN/). This region of zebrafish linkage group 3 is syntenic to the human chromosome 17 region.…”