Rapid DNA extraction and PCR validation for direct detection of Listeria monocytogenes in raw milk

Abstract

Objetivo. Validar un método para la detección directa de L. monocytogenes en leche cruda. Materiales y métodos. Se utilizó un procedimiento de extracción con el agente caotropico NaI, para reducir la grasa en la muestra a un 0.2% p/v, el cual es mas bajo limite de detección con el método de Gerber para evitar la polimerización. Las muestras de leche cruda fueron analizadas por el método estandar de oro para la detección de L. monocytogenes. La detección por PCR fue realizada amplificando el segmento específico de 938bp de 16S ADNr. Los siguientes cebadores fueron utilizados L1 (CTCCATAAAGGTGACCCT), U1 (CAGCMGCCGCGGTAATWC), LF (CAAACGTTAACAACGCAGTA) and LR (TCCAGAGTGATCGATGTTAA) que reconoce el gen hlyA de L. monocytogenes y que amplifica un fragmento de 750bp.Resultados. El ADN de 39 cepas evidenció una alta especificidad de la técnica ya que todas las 39 L. monocytogenes amplificaron los fragmentos de 938bp y 750bp especie especifica. El límite de detección de la PCR fue de 101 CFU/ml. La reproducibilidad de la PCR mostró un Kappa de 0.85, la especificidad y sensibilidad fueron del 100%. El valor predictivo positivo y negativo fue del 100%. Conclusiones. Los resultados demostraron que es posible detectar Listeria spp usando cualquiera de los tres métodos ya que poseen la misma sensibilidad y especificidad. El 100% del valor predictivo positivo provee una alta posibilidad de detección en muestras positivas con listeria. EL método de extracción y la PCR estandarizada permiten en 15 días detectar L. monocytogenes en leches crudas. La técnica de PCR puede ser adaptada y validada otros tipos de alimentos como pollos, carnes y quesos.

An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

“…The specific detection of the genus Listeria by PCR involves PCR primers based on the highly conserved 16S rRNA sequence present in all Listeria sp. with a resulting 938 bp amplification product ( Levin, 2003 ; Burbano et al, 2006 ; Goh et al, 2012 ; Jamali et al, 2013 ). L. monocytogenes can be differentiated from other Listeria sp.…”

“…In addition, PCR method also detects L. monocytogenes at the species level by targeting the virulence genes of the organism ( Levin, 2003 ). Several virulence genes have been identified in L. monocytogenes and targeted for the PCR detection of the organism, for example, hly ( hlyA ) gene codes for listeriolysin O (LLO; Deneer and Boychuk, 1991 ; Johnson et al, 1992 ; Agersborg et al, 1997 ; Aznar and Alarcón, 2003 ; Amagliani et al, 2004 ; Burbano et al, 2006 ), iap gene codes for an invasion-associated protein known as p60 ( Agersborg et al, 1997 ; Aznar and Alarcón, 2003 ; Swetha et al, 2012 ), actA gene codes for a surface protein known as ActA which is required for intracellular bacterial propulsion and cell to cell invasion ( Moriishi et al, 1998 ; Levin, 2003 ), lma A gene codes for L. monocytogenes antigen (lmaA), which also known as Dth -18 gene codes for delayed-type hypersensitivity protein (DTH-18 factor; Wernars et al, 1991 ; Johnson et al, 1992 ; Levin, 2003 ), inlA gene codes for internalin A ( Almeida and Almeida, 2000 ; Ingianni et al, 2001 ; Jung et al, 2003 ), inlB gene codes for internalin B ( Pangallo et al, 2001 ; Jung et al, 2003 ), prfA gene codes for positive regulator factor A (PrFA; Simon et al, 1996 ), pepC codes for aminopeptidase C ( Winters et al, 1999 ), fbp gene codes for fibronectin-binding protein ( Gilot and Content, 2002 ) and plcB Phospholipase C protein ( Volokhov et al, 2002 ). Among these targeted genes, the hly A gene is the most frequently chosen target gene for the PCR detection of L. monocytogenes ( Aznar and Alarcón, 2003 ; Jadhav et al, 2012 ).…”

Assessment of a multiplex detection method for Salmonella enterica, Escherichia coli O157:H7, and Listeria monocytogenes in cow milk

“…The use of a molecular platform for the simultaneous detection of S. enterica, E. coli O157:H7, and L. monocytogenes, with different sensitivity degrees, has been reported for different foods. Using a Real-Time PCR approach, these three microorganisms were detected in milk after an incubation period of 18 hours at 35 • C, with a sensitivity of 1 cell/mL, for each microorganism [8,28,29]. The same technique has been applied in vegetables with a detection sensitivity of 1-10 cells/mL for Salmonella and E. coli O157:H7 and 1 000 cells/mL for L. monocytogenes [13].…”

“…The pair of primers used for the detection of S. enterica was designed to amplify a histidine transport protein-coding gen which is highly conserved within this genus [26][27]. The listeriolysin O-coding gene hlyA (LLO) is a specific virulence factor for L. monocytogenes, and its amplification in PCR strategies is an excellent target for PCR-detection of L. monocytogenes contamination in meat and dairy products [28,29].…”

“…1.5 U of Taq Platinum R (Invitrogen, USA), and 5 µl DNA (∼100 ng of DNA). The set of primers used in each reaction targeted highly conserved genes of S. enterica (gene hisJ)[26,27], L. monocytogenes (gene hlyA)[25,28,29], and E. coli O157:H7 (genes vt 1 and vt 2 ) [30]. Primers targeting S. enterica and E. coli O157:H7 genes were used at a final concentration of 5 pmol, and primers targeting the L. monocytogenes gene were used at a concentration of 40 pmol.…”