Rapid simultaneous genotyping of the frequent butyrylcholinesterase variants Asp70Gly and Ala539Thr with fluorescent hybridization probes

Gätke, Mona Ring; Viby‐Mogensen, J.; Bundgaard, Jens R.

doi:10.1080/00365510260296537

Cited by 8 publications

(4 citation statements)

References 35 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…For single nucleotide polymorphism analysis a 214 base‐pair PCR product was amplified using the forward primer (5′‐CTGTACTGTGTAGTTAGAGAAAATGGC‐3′, nucleotide −105 to −79 upstream to the intron3/exon4 boundary) and the reverse primer (5′‐CTTTCTTTCTTGCTAGTGTAATCG‐3′, nucleotides 1709–1686). A fluorescein‐ labelled anchor probe (5′‐CCAGCGATGGAATCCTGCTTTCC‐3′‐fluorescein, nucleotides 1628–50) and a LC‐Red‐640‐labelled detection probe (5′‐CTCCCATTCTGCTTCATCAATATT‐3′‐phosphate, nucleotides 1603–26) were used as previously reported [29, 30] .…”

Section: Methodsmentioning

confidence: 99%

Butyrylcholinesterase interactions with amylin may protect pancreatic cells in metabolic syndrome

Shenhar‐Tsarfaty¹,

Bruck²,

Bennett³

et al. 2011

Journal of Cellular and Molecular Medicine

View full text Add to dashboard Cite

The metabolic syndrome (MetS) is a risk factor for type 2 diabetes mellitus (T2DM). However, the mechanisms underlying the transition from MetS to T2DM are unknown. Our goal was to study the potential contribution of butyrylcholinesterase (BChE) to this process. We first determined the hydrolytic activity of BChE in serum from MetS, T2DM and healthy individuals. The ‘Kalow’ variant of BChE (BChE-K), which has been proposed to be a risk factor for T2DM, was genotyped in the last two groups. Our results show that in MetS patients serum BChE activity is elevated compared to T2DM patients and healthy controls (P < 0.001). The BChE-K genotype showed similar prevalence in T2DM and healthy individuals, excluding this genotype as a risk factor for T2DM. However, the activity differences remained unexplained. Previous results from our laboratory have shown BChE to attenuate the formation of β-amyloid fibrils, and protect cultured neurons from their cytotoxicity. Therefore, we next studied the in vitro interactions between recombinant human butyrylcholinesterase and amylin by surface plasmon resonance, Thioflavine T fluorescence assay and cross-linking, and used cultured pancreatic β cells to test protection by BChE from amylin cytotoxicity. We demonstrate that BChE interacts with amylin through its core domain and efficiently attenuates both amylin fibril and oligomer formation. Furthermore, application of BChE to cultured β cells protects them from amylin cytotoxicity. Taken together, our results suggest that MetS-associated BChE increases could protect pancreatic β-cells in vivo by decreasing the formation of toxic amylin oligomers.

show abstract

Section: Methodsmentioning

confidence: 99%

Butyrylcholinesterase interactions with amylin may protect pancreatic cells in metabolic syndrome

Shenhar‐Tsarfaty¹,

Bruck²,

Bennett³

et al. 2011

Journal of Cellular and Molecular Medicine

View full text Add to dashboard Cite

show abstract

“…For single nucleotide polymorphism analysis, a 214-bp PCR product was amplified using the forward primer 5′-CTGTACTGTGTAGTTAGAGAAAATGGC-3′ (nucleotide −105 to −79 upstream to the intron 3/exon 4 boundary) and the reverse primer 5′-CTTTCTTTCTTGCTAGTGTAATCG-3′ (nucleotides 1709-1686). A fluorescein-labeled anchor probe (5′-CCAGCGATGGAATCCTGCTTTCC-3′-FLU (fluorescein), nucleotides 1628–50) and a one base apart LC-Red-640-labeled detection probe (5′-CTCCCATTCTGCTTCATCAATATT-3′-PHO (phosphate), nucleotides 1603-26) were used as reported previously (35). …”

Section: Methodsmentioning

confidence: 99%

The Butyrylcholinesterase K Variant Confers Structurally Derived Risks for Alzheimer Pathology♦

Podoly

Shalev

Shenhar‐Tsarfaty

et al. 2009

Journal of Biological Chemistry

View full text Add to dashboard Cite

The K variant of butyrylcholinesterase (BChE-K, 20% incidence) is a long debated risk factor for Alzheimer disease (AD). The A539T substitution in BChE-K is located at the C terminus, which is essential both for BChE tetramerization and for its capacity to attenuate β-amyloid (Aβ) fibril formation. Here, we report that BChE-K is inherently unstable as compared with the “usual” BChE (BChE-U), resulting in reduced hydrolytic activity and predicting prolonged acetylcholine maintenance and protection from AD. A synthetic peptide derived from the C terminus of BChE-K (BSP-K), which displayed impaired intermolecular interactions, was less potent in suppressing Aβ oligomerization than its BSP-U counterpart. Correspondingly, highly purified recombinant human rBChE-U monomers suppressed β-amyloid fibril formation less effectively than dimers, which also protected cultured neuroblastoma cells from Aβ neurotoxicity. Dual activity structurally derived changes due to the A539T substitution can thus account for both neuroprotective characteristics caused by sustained acetylcholine levels and elevated AD risk due to inefficient interference with amyloidogenic processes.

show abstract

“…If this probe is mismatched, melting will occur at a lower temperature. 30,31 When the two dyes are no longer in close proximity, the fluorescence signal decreases.…”

Section: Introductionmentioning

confidence: 99%

Genotyping Parkinson Disease-Associated Mitochondrial Polymorphisms

Jiang¹,

Ellis²,

Greenlee³

2004

Clinical Medicine & Research

View full text Add to dashboard Cite

OBJECTIVEThe purpose of this study was to establish a system for rapidly detecting single nucleotide polymorphisms (SNPs) in mitochondrial DNA (mtDNA) using hybridization probes and melting temperature (Tm) analysis. This technology should prove useful for population-based studies on the interaction between genetic factors and environmental exposures and the risk of Parkinson disease (PD). METHODSMitochondrial DNA (mtDNA) was extracted from whole blood. Rapid polymerase chain reaction (PCR) and melting curve analyses were performed with primers and fluorochrome-labeled probes on a LightCycler (Roche Molecular Biochemical, Mannheim, Germany). Genotyping of 10 SNPs in 15 subjects was based on the analysis of allele-specific Tm of detection probes. The results of melting curve analyses were verified by sequencing all 150 PCR products. RESULTSReal-time monitoring showed optimal PCR amplification of each mtDNA fragment. The nucleotide changes at positions 1719, 4580, 7028, 8251, 9055, 10398, 12308, 13368, 13708, and 16391 from wild-type to mutant genotype resulted in 6. 51, 8.29, 3.26, 7.82, 4.79, 2.84, 2.73, 9.04, 8.53, and 9.52˚C declines in Tm of the detection probes, respectively. Genotyping of all 150 samples was verified by 100% correspondence with the results of sequencing. Fourteen subjects were haplogrouped by combining results for all 10 SNPs. CONCLUSION A rapid and reliable detection system for identifying mitochondrial polymorphisms and haplotypes was developed based on hybridization probe technology. This method may be suitable for mitochondrial genotyping of samples from large-scale epidemiology studies, and may prove useful for exploring the molecular etiopathogenesis of PD, identifying markers of genetic susceptibility, and protecting susceptible individuals from PD.

show abstract

Rapid simultaneous genotyping of the frequent butyrylcholinesterase variants Asp70Gly and Ala539Thr with fluorescent hybridization probes

Abstract: A high-speed and easy to perform mutation detection assay has been established for the two most common mutations, Asp70Gly and Ala539Thr, in BChE, using the LightCycler technology and melting curves.

Cited by 8 publications

References 35 publications

Butyrylcholinesterase interactions with amylin may protect pancreatic cells in metabolic syndrome

Butyrylcholinesterase interactions with amylin may protect pancreatic cells in metabolic syndrome

The Butyrylcholinesterase K Variant Confers Structurally Derived Risks for Alzheimer Pathology♦

Genotyping Parkinson Disease-Associated Mitochondrial Polymorphisms

Contact Info

Product

Resources

About