Rational design of inducible CRISPR guide RNAs for de novo assembly of transcriptional programs

Ferry, Quentin R. V.; Lyutova, Radostina; Fulga, Tudor A.

doi:10.1038/ncomms14633

Cited by 84 publications

(95 citation statements)

References 41 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…1d, 2). Importantly however, when tested in a gRNA functional reporter assay 4,22 , all tRNAs with the exception of rice tRNA Gly enabled efficient transcriptional activation at levels equivalent to U6, in the absence of any additional Pol-II or Pol-III promoters ( Supplementary Fig. 1e, f, 3a).…”

Section: Rationale For Trna Variant Screeningmentioning

confidence: 99%

“…To allow the functional analyses to be performed only on cells which had received all necessary plasmids, we inserted a SV40 promoter-mCherry-SV40 polyA cassette into the backbone of the 8xCTS2-mCMVp-ECFP construct (REF 22 ) between the PciI and SalI sites. The insert was amplified from an available plasmid using primers which added the PciI and SalI sites respectively (Forward: TGCTTACATGTGGAATGTGTGTCAGTTAG, Reverse:…”

Section: Cloning and Construct Assembly -8xcts2 Reporter Modificationmentioning

confidence: 99%

See 1 more Smart Citation

Decoupling tRNA promoter and processing activities enables specific Pol-II Cas9 guide RNA expression

Knapp

Michaels

Jamilly

et al. 2018

Preprint

View full text Add to dashboard Cite

Spatial/temporal control of Cas9 guide RNA expression could considerably expand the utility of CRISPR-based technologies. Current approaches based on tRNA processing offer a promising strategy but suffer from high background. Here we developed a variant screening platform to identify differential sequence determinants of human tRNA promoter and processing activities. Rational design based on the ensuing principles allowed us to engineer an improved tRNA scaffold that enabled highly specific guide RNA production from a Pol-II promoter.

show abstract

Section: Rationale For Trna Variant Screeningmentioning

confidence: 99%

Section: Cloning and Construct Assembly -8xcts2 Reporter Modificationmentioning

confidence: 99%

Decoupling tRNA promoter and processing activities enables specific Pol-II Cas9 guide RNA expression

Knapp

Michaels

Jamilly

et al. 2018

Preprint

View full text Add to dashboard Cite

show abstract

“…Systematic mapping of the structure and sequence properties of functional gRNAs has revealed that Cas9 activity is tolerant to significant modifications the standard gRNA structure, 21,22 facilitiating introduction of auxiliary domains that enable conditional control of gRNA activity via structural changes induced by small-molecules, 23,24 protein-bound RNAs, 25 nucleases, 26 or nuclease-recruiting DNAs. 26 Alternatively, the activity of standard gRNAs has been modulated by antisense RNAs 27 or by photolysis of antisense DNAs incorporating photocleavable groups. 28 Here, pursuing the scRNA paradigm of programmable conditional regulation based on dynamic RNA nanotechnology, and leveraging information on tolerated modifications of standard gRNA structure, we set out to engineer conditional guide RNAs (cgRNAs) that change conformation in response to an RNA trigger X to conditionally direct the function of dCas9 to a target gene Y.…”

Section: Introductionmentioning

confidence: 99%

Conditional Guide RNAs: Programmable Conditional Regulation of CRISPR/Cas Function in Bacteria via Dynamic RNA Nanotechnology

Hanewich-Hollatz

Chen

Huang

et al. 2019

Preprint

View full text Add to dashboard Cite

Dynamic RNA Nanotechnology in Living Cells Programmable RNA trigger X dCas9 Constitutively inactive (OFF ON logic) cgRNA Y Programmable DNA target Constitutively active (ON OFF logic) X dCas9 Y cgRNAA guide RNA (gRNA) directs the function of a CRISPR protein effector to a target gene of choice, providing a versatile programmable platform for engineering diverse modes of synthetic regulation (edit, silence, induce, bind). However, the fact that gRNAs are constitutively active places limitations on the ability to confine gRNA activity to a desired location and time. To achieve programmable control over the scope of gRNA activity, here we apply principles from dynamic RNA nanotechnology to engineer conditional guide RNAs (cgRNAs) whose activity is dependent on the presence or absence of an RNA trigger. These cgRNAs are programmable at two levels, with the trigger-binding sequence controlling the scope of the effector activity and the target-binding sequence determining the subject of the effector activity. We demonstrate molecular mechanisms for both constitutively active cgRNAs that are conditionally inactivated by an RNA trigger (ON→OFF logic) and constitutively inactive cgRNAs that are conditionally activated by an RNA trigger (OFF→ON logic). For each mechanism, automated sequence design is performed using the reaction pathway designer within NUPACK to design an orthogonal library of three cgRNAs that respond to different RNA triggers. In E. coli expressing cgRNAs, triggers, and silencing dCas9 as the protein effector, we observe programmable conditional gene silencing with a median dynamic range of ≈6-fold for an ON→OFF "terminator switch" mechanism, ≈15-fold for an ON→OFF "splinted switch" mechanism, and ≈3.6-fold for an OFF→ON "toehold switch" mechanism; the median crosstalk within each cgRNA library is <2%, <2%, and ≈20% for the three mechanisms. By providing programmable control over both the scope and target of protein effector function, cgRNA regulators offer a promising platform for synthetic biology.

show abstract

“…For example, in some of our tests below, we used binding of a fluorescently tagged MS2 viral coat protein to an MS2 RNA hairpin segment within the design as an output ( Figure 1A & 1B); such interactions underlie most systems for CRISPR interference and activation and in situ RNA visualization. [2][3][4][5][6][19][20][21] The user only needs to specify the sequence and 'active' secondary structure of this output element and RiboLogic will place this sequence relative to the input aptamer element and optimize surrounding sequences during its design process.…”

mentioning

confidence: 99%

Automated design of highly diverse riboswitches

Andreasson

Kladwang

et al. 2019

Preprint

View full text Add to dashboard Cite

Riboswitches that couple binding of ligands to recruitment of molecular machines offer sensors and control elements for RNA synthetic biology and medical biotechnology. Current approaches to riboswitch design enable significant changes in output activity in the presence vs. absence of input ligands. However, design of these riboswitches has so far required expert intuition and explicit specification of complete target secondary structures, both of which limit the structuretoggling mechanisms that have been explored. We present a fully automated method called RiboLogic for these design tasks and high-throughput experimental tests of 2,875 molecules using RNA-MaP (RNA on a massively parallel array) technology. RiboLogic designs explore an unprecedented diversity of structure-toggling mechanisms validated through experimental tests. These synthetic molecules consistently modulate their affinity to the MS2 bacteriophage coat protein upon binding of flavin mononucleotide, tryptophan, theophylline, and microRNA miR-208a, achieving activation ratios of up to 20 and significantly better performance than control designs. The data enable dissection of features of structure-toggling mechanisms that correlate with higher performance. The diversity of RiboLogic designs and their quantitative experimental characterization provides a rich resource for further improvement of riboswitch models and design methods. Main textBiological systems rely on precise regulation of cellular processes. In particular, regulatory RNAs, including riboswitches, play major roles in biological circuits, sensing molecules in the cellular milieu and then modulating gene expression and other processes in a wide variety of natural systems. 1 The ability to perform de novo design of arbitrary riboswitches that interact with other biomolecules in their environments would have broad impacts in synthetic biology as well as for RNA diagnostics and therapeutics. Supporting these efforts, there are a rapidly growing number of synthetic and natural RNA 'aptamer' sequences that bind drugs, metabolites, proteins, and other biologically important molecules that might be incorporated into novel riboswitches. Many applications of these riboswitches, including fluorescent biosensors, 2-6 require reversible riboswitches with tight binding to reporters in their ON states, and this criterion necessitates a tradeoff with good activation ratios, defined as the ratio in observed signal in the presence and absence of a trigger molecule. 7Riboswitches are multi-stable RNA molecules, meaning they can form multiple secondary structures. The preferred states can be toggled by small molecule inputs or RNA oligonucleotides that bind aptamers or complementary regions embedded in the RNA ( Figure 1A). So far, the majority of riboswitch design studies involve manual design of the desired states and require detailed specification of the structure-toggling mechanism. 7 For reversible switches, these efforts have required significant trial-and-error; success has been achieved through ...

show abstract

Rational design of inducible CRISPR guide RNAs for de novo assembly of transcriptional programs

Cited by 84 publications

References 41 publications

Decoupling tRNA promoter and processing activities enables specific Pol-II Cas9 guide RNA expression

Decoupling tRNA promoter and processing activities enables specific Pol-II Cas9 guide RNA expression

Conditional Guide RNAs: Programmable Conditional Regulation of CRISPR/Cas Function in Bacteria via Dynamic RNA Nanotechnology

Automated design of highly diverse riboswitches

Contact Info

Product

Resources

About