Reactivation of the silenced and imprinted alleles of ARHI is associated with increased histone H3 acetylation and decreased histone H3 lysine 9 methylation

Fujii, Satoshi; Luo, Robert Z.; Yuan, Jiuhong; Kadota, Mitsutaka; Oshimura, Mitsuo; Dent, Sharon Y.R.; Kondo, Yutaka; Issa, Jean–Pierre J.; Bast, Robert C.; Yu, Yinhua

doi:10.1093/hmg/ddg204

Cited by 63 publications

(62 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Epigenetic modifications of DNA and histones are involved in gene regulation by altering chromatin structure (Fujii et al, 2003). In this report we demonstrated that DNA methylation and histone modifications regulate HSulf-1 expression and Epigenetic silencing of HSulf-1 J Staub et al provided the first evidence of methylation in combination with chromatin histone modification as a mechanism of HSulf-1 inactivation in ovarian cancer.…”

Section: Discussionmentioning

confidence: 52%

Epigenetic silencing of HSulf-1 in ovarian cancer:implications in chemoresistance

et al. 2007

View full text Add to dashboard Cite

To investigate the mechanism by which HSulf-1 expression is downregulated in ovarian cancer, DNA methylation and histone acetylation of HSulf-1 was analysed in ovarian cancer cell lines and primary tumors. Treatment of OV207 and SKOV3 by 5-aza-2 0 -deoxycytidine resulted in increased transcription of HSulf-1. Sequence analysis of bisulfite-modified genomic DNA from ovarian cell lines and primary tumors without HSulf-1 expression revealed an increase in the frequency of methylation of 12 CpG sites in exon 1A. Chromatin immunoprecipitation assays showed an increase in histone H3 methylation in cell lines without HSulf-1 expression. To assess the significance of HSulf-1 downregulation in ovarian cancer, OV167 and OV202 cells were transfected with HSulf-1 siRNA. Downregulation of HSulf-1 expression in OV167 and OV202 cells lead to an attenuation of cisplatin-induced cytotoxicity. Moreover, patients with ovarian tumors expressing higher levels of HSulf-1 showed a 90% response rate (27/30) to chemotherapy compared to a response rate of 63% (19/30) in those with weak or moderate levels (P ¼ 0.0146, v 2 test). Collectively, these data indicate that HSulf-1 is epigenetically silenced in ovarian cancer and that epigenetic therapy targeting HSulf-1 might sensitize ovarian tumors to conventional first-line therapies.

show abstract

Section: Discussionmentioning

confidence: 52%

Epigenetic silencing of HSulf-1 in ovarian cancer:implications in chemoresistance

et al. 2007

View full text Add to dashboard Cite

show abstract

“…Normal breast epithelial cells NBE234 and NBE231 and normal ovarian epithelial cells OSE113, OSE115, OSE106, and OSE120 were cultured as described previously (29). SKBr3, BT20, MDA-MB-468, and MDA-MB-435 breast cancer cells were maintained in RPMI 1640 supplemented with 10% fetal bovine serum (FBS).…”

Section: Methodsmentioning

confidence: 99%

A Ras Homologue Member I Directly Inhibits Signal Transducers and Activators of Transcription 3 Translocation and Activity in Human Breast and Ovarian Cancer Cells

Nishimoto

Lü

et al. 2005

Cancer Research

View full text Add to dashboard Cite

A Ras homologue member I (ARHI) is a novel imprinted tumor suppressor gene whose expression is frequently lost in breast and ovarian cancers. This small GTP-binding protein is a member of the Ras superfamily with significant homology to both Ras and Rap. Unlike the Ras oncogene, however, ARHI inhibits tumor cell growth. To elucidate the mechanisms by which ARHI inhibits cancer growth, we screened a human breast epithelial cell cDNA library using a yeast two-hybrid system for ARHI-interacting proteins. ARHI was found to interact with signal transducers and activators of transcription (STAT) 3, a latent transcription factor that transduces signals from the cell surface to the nucleus and activates gene transcription. STAT3 is frequently phosphorylated and activated in breast and ovarian cancers, where cytokines and growth factors up-regulate STAT3 and stimulate proliferation. The ARHI-STAT3 interaction was confirmed by coimmunoprecipitation in mammalian cells and shown to be specific for STAT3 but not STAT1 or STAT5a. When ARHI and STAT3 were coexpressed in SKOv3 cells, ARHI formed a complex with STAT3 in the cytoplasm and prevented interleukin-6-induced STAT3 accumulation in the nucleus. ARHI markedly reduced STAT3 binding to DNA and STAT3-dependent promoter activity while only moderately affecting STAT3 phosphorylation. Deletion of the NH 2 terminus of ARHI significantly compromised its inhibitory activity, suggesting that this unique NH 2 -terminal extension contributes to ARHI's inhibition of STAT3-mediated transcriptional activity. Thus, the physical association between STAT3 and ARHI as well as the functional inhibition of STAT3 transcriptional activity by ARHI suggests a novel mechanism through which a putative tumor suppressor gene can inhibit STAT3 activity in breast and ovarian cancers. (Cancer Res 2005; 65(15): 6701-10)

show abstract

“…The ChIP assay was carried out as previously described (Fujii et al, 2003). The PCR conditions for the EZH2 gene (Gene Accession Number NC_000007.12) promoter, which contains or does not contain Elk-1 biding motifs, were applied with the following three primer pairs: ChIP primer 1 which contains three Elk-1 binding motifs (5 0 to 3 0 ): TTAAAACCGTTACCA CCCCCGAGTTTTGAA and TTCGCTGTAAGGGACGCC ACTGGCCGTGT, ChIP primer 2 which contains two Elk-1 binding motifs (5 0 to 3 0 ): AACTCTGCGGCGCCGGTT CCCGCCAAGA and TTCGCTGTAAGGGACGCCACTG GCCGTGT and ChIP primer 3 which does not contain any Elk-1 binding motifs (5 0 to 3 0 ): ACGAACAGTGGA AGGGTCTG and GGAGTTTCGCTCTGGTTGTC.…”

Section: Chromatin Immunoprecipitation Assaymentioning

confidence: 99%

MEK–ERK pathway regulates EZH2 overexpression in association with aggressive breast cancer subtypes

et al. 2011

View full text Add to dashboard Cite

EZH2 overexpression occurs in various malignancies and is associated with a poor outcome. We have so far demonstrated that EZH2 downregulates the important genes such as E-cadherin and RUNX3 by increasing histone H3K27 trimethylation. However, the mechanism of EZH2 overexpression in various cancer cells remains unclear. In this study we carried out a promoter analysis of the EZH2 gene and investigated whether a survival signal that is upregulated in cancer cells is related to overexpression at the transcription level. We also explored the clinical relevance of the signaling pathway that leads to EZH2 overexpression in breast cancer and demonstrated that MEK-ERK1/2-Elk-1 pathway leads to EZH2 overexpression. The triple-negative and ERBB2-overexpressing subtypes of breast cancer are known to contain more rapidly proliferating breast cancer cells. The signaling pathway connected to EZH2 overexpression was associated with both aggressive subtypes of breast cancer. We show the significance that overexpression of histone modifier protein EZH2 in cancer cells and our study could pave the way for EZH2 inhibition to become an efficient treatment for more aggressive breast cancers.

show abstract

Reactivation of the silenced and imprinted alleles of ARHI is associated with increased histone H3 acetylation and decreased histone H3 lysine 9 methylation

Cited by 63 publications

References 37 publications

Epigenetic silencing of HSulf-1 in ovarian cancer:implications in chemoresistance

Epigenetic silencing of HSulf-1 in ovarian cancer:implications in chemoresistance

A Ras Homologue Member I Directly Inhibits Signal Transducers and Activators of Transcription 3 Translocation and Activity in Human Breast and Ovarian Cancer Cells

MEK–ERK pathway regulates EZH2 overexpression in association with aggressive breast cancer subtypes

Contact Info

Product

Resources

About