Recombineering: Genetic Engineering in Bacteria Using Homologous Recombination

Thomason, Lynn C.; Court, Donald L.; Bubunenko, Mikail; Costantino, Nina; Wilson, Helen Rose; Datta, Simanti; Oppenheim, Amos B.

doi:10.1002/0471142727.mb0116s78

Cited by 170 publications

(168 citation statements)

References 29 publications

Supporting

Mentioning

165

Contrasting

Unclassified

Order By: Relevance

“…The viral IL-10 deletion (vIL-10 del) virus RVAdIL10C has a UL111A gene deletion in HCMV strain AD169 (20). Merlin-BAC UL111A-del virus was generated from the enhanced green fluorescent protein (eGFP)-expressing HCMV Merlin-BAC isolate pAL1160 (21) using bacterial artificial chromosome (BAC) recombineering protocols (22). The selection cassette was generated using the PCR primers: 5=-GA CGCGCAGTTGGGCGGCGGATTGGGGCGGCATGCTGCGGCGGAG CTCGGTACCCGGGGATC-3= (forward) and 5=-GTAACTGGGTGAAC GACATCGGAGCGGACTGCAAATCGCAACGGAAAAGTGCCACCT GTATGC-3= (reverse).…”

Section: Cellsmentioning

confidence: 99%

Human Cytomegalovirus Interleukin-10 Polarizes Monocytes toward a Deactivated M2c Phenotype To Repress Host Immune Responses

Avdic

Cao

McSharry

et al. 2013

J Virol

View full text Add to dashboard Cite

Section: Cellsmentioning

confidence: 99%

Human Cytomegalovirus Interleukin-10 Polarizes Monocytes toward a Deactivated M2c Phenotype To Repress Host Immune Responses

Avdic

Cao

McSharry

et al. 2013

J Virol

View full text Add to dashboard Cite

“…To study the role of pUL93 in the HCMV life cycle, we engineered a UL93 stop mutant (UL93st-TB40/E-BAC) by replacing the initiating codon (ATG) in UL93 with a stop codon (TAG) using two-step bacterial artificial chromosome (BAC) recombineering (Fig. 1A) (17)(18)(19). BAC constructs were validated by restriction fragment length polymorphism (RFLP) and PCR sequencing of the region of the BAC genome containing this change (data not shown).…”

mentioning

confidence: 99%

Human Cytomegalovirus pUL93 Is Required for Viral Genome Cleavage and Packaging

DeRussy

Tandon

2015

J Virol

View full text Add to dashboard Cite

Human cytomegalovirus (HCMV) pUL93 is essential for virus growth, but its precise function in the virus life cycle is unknown. Here, we characterize a UL93 stop mutant virus (UL93st-TB40/E-BAC) to demonstrate that the absence of this protein does not restrict viral gene expression; however, cleavage of viral DNA into unit-length genomes as well as genome packaging is abolished. Thus, pUL93 is required for viral genome cleavage and packaging.H uman cytomegalovirus (HCMV) protein pUL93, a putative tegument protein, is required for the growth of HCMV (1, 2), but the exact function of this protein is unknown. There is no functional study done to date on HCMV pUL93; however, pUL17, the positional homolog of pUL93 in herpes simplex virus 1 (HSV-1), has been shown to be required for the localization of capsids to the DNA replication compartments in the infected cell nucleus, where viral genome cleavage and packaging take place (3, 4). pUL17 has also been found to interact with pUL25, a homolog of HCMV pUL77, to form the capsid vertex-specific component (CVSC), which is found at the 12 vertices of the icosahedral capsid (4-10). The exact function of the CVSC is currently unknown, but it is thought to aid in capsid stability and nuclear egress (10-13). pUL25-null mutants package viral DNA only transiently and produce mostly empty capsids, while pUL17-null mutants completely abolish DNA packaging (3,14). It is important to note that pUL17 and pUL93 are positional homologs that share only 1.5% sequence identity, 1.9% sequence similarity, and no distinct conserved domains (based on amino acid ClustalW alignment). Moreover, several HCMV proteins have been found to have very different functions compared to their homologs in other herpesviruses, highlighting the importance of studying HCMV proteins independently. For example, HCMV pUL50 and pUL53 were presumed to recruit host protein kinase C (PKC) for disruption of the nuclear lamina based on data from other herpesviruses but were instead found to recruit viral protein kinase pUL97 for this purpose (15). Targeting of essential structural viral proteins holds great promise for the development of antivirals that would be highly specific and effective and also less susceptible to the development of resistance be- Citation DeRussy BM, Tandon R. 2015. Human cytomegalovirus pUL93 is required for viral genome cleavage and packaging.

show abstract

“…A virus truncated by this region of pUL96 is arrested for growth in cell culture (6). To map the amino acids that determine pUL96 function in virus maturation, we engineered several point and clustered mutations replacing these amino acids in Towne-BAC by genetic recombineering (5,6,24) (Fig. 2 and 3).…”

Section: Resultsmentioning

confidence: 99%

Highly Acidic C-Terminal Region of Cytomegalovirus pUL96 Determines Its Functions during Virus Maturation Independently of a Direct pp150 Interaction

Brechtel¹,

Mocarski²,

Tandon³

2014

J Virol

View full text Add to dashboard Cite

Tegument proteins pp150 and pUL96 function at a late step in cytomegalovirus (CMV) maturation. Here, we show that pp150 interacts directly with pUL96; however, the N-terminal region of pp150 and the C-terminal region of pUL96, which are critical for these proteins to function, are not required for this interaction. Moreover, the largely dispensable C-terminal region of pp150 is critical for pp150-pUL96 interaction. To further study the role of pUL96, several point and clustered mutations were engineered into the CMV Towne bacterial artificial chromosome (Towne-BAC) genome, replacing the conserved negatively charged C-terminal residues of pUL96. Although individual point mutations (E 122 A, D 124 A, and D 125 A) reduced virus growth slightly, the clustered mutations of 122 EVDDAV 127 significantly reduced virus growth, produced small syncytial plaque phenotypes, and impacted a late stage of virus maturation. When the UL96 C-terminal alanine conversion mutant (B6-BAC) virus was serially passaged in cell culture, it gained a plaque size comparable to that of Towne-BAC, displayed an altered restriction fragment length pattern, and replicated with increased growth kinetics. Whole-genome sequencing of this passaged virus (UL96P10) and the similarly passaged Towne-BAC virus revealed major differences only in the RNA4.9 and UL96 regions. When one of the mutations in the UL96 coding region was engineered into the B6-BAC virus, it significantly increased the plaque size and rescued the virus growth rate. Thus, accumulation of compensatory mutations only in UL96 in this revertant and the specific involvement of functionally dispensable regions of pp150 in the pUL96-pp150 interaction point toward a role for pUL96 in virus maturation that does not depend upon pp150. IMPORTANCEHuman cytomegalovirus causes significant medical problems in newborns, as well as in people with low immunity. In this study, we investigated the functions of two essential virus proteins, pp150 and pUL96, and determined the impact of their mutual interaction on virus replication. These studies provide valuable information that is critical for the development of targeted antiviral therapies. The proteinaceous layer between the capsid and the envelope in a herpesvirus virion, known as the tegument, is analogous to the matrix layer found in some RNA viruses. Tegument proteins function in at least four different ways; they (i) are delivered into host cells upon virus entry as prepackaged transactivation factors that can promote infection, e.g., cytomegalovirus (CMV) pp71 (1, 2); (ii) are critical for the acquisition of the virus envelope and act as a bridge between the nucleocapsids and the envelope layer (3, 4); (iii) provide capsid stability during virus maturation and trafficking, e.g., CMV pp150 and pUL96 (5, 6); and (iv) help in the trafficking of virus in the cell by engaging the host cytoskeleton, e.g., herpes simplex virus (HSV) UL36 (7-9). Herpesvirus tegument has been thought to be amorphous in nature (3, 4, 10), although a more ordered s...

show abstract

Recombineering: Genetic Engineering in Bacteria Using Homologous Recombination

Cited by 170 publications

References 29 publications

Human Cytomegalovirus Interleukin-10 Polarizes Monocytes toward a Deactivated M2c Phenotype To Repress Host Immune Responses

Human Cytomegalovirus Interleukin-10 Polarizes Monocytes toward a Deactivated M2c Phenotype To Repress Host Immune Responses

Human Cytomegalovirus pUL93 Is Required for Viral Genome Cleavage and Packaging

Highly Acidic C-Terminal Region of Cytomegalovirus pUL96 Determines Its Functions during Virus Maturation Independently of a Direct pp150 Interaction

Contact Info

Product

Resources

About