REF4 and RFR1, Subunits of the Transcriptional Coregulatory Complex Mediator, Are Required for Phenylpropanoid Homeostasis in Arabidopsis

Bonawitz, Nicholas D.; Soltau, Whitney L.; Blatchley, Michael R.; Powers, Brendan L.; Hurlock, Anna K.; Seals, Leslie A.; Weng, Jing-Ke; Stout, Jake; Chapple, Clint

doi:10.1074/jbc.m111.312298

Cited by 110 publications

(126 citation statements)

References 46 publications

Supporting

Mentioning

121

Contrasting

Order By: Relevance

“…The first has a C-to-T nonsense mutation in the 10th exon of MED5b (TAGGTTCCGTAACTTGCTTG), which terminates the protein after Pro-650 ( Figure 12B), and the other two have the same G-to-A nonsense mutation in the 10th exon of MED5b (AGTGTATCATGAACTCTTCCTT), which results in an early stop after Ser-671 ( Figure 12B). It has been shown previously that the Arabidopsis Mediator subunit MED5b/RFR1 and its paralog, MED5a/REF4, function semiredundantly in the repression of phenylpropanoid biosynthesis and med5a med5b double mutants contain increased levels of phenylpropanoids (Bonawitz et al, 2012(Bonawitz et al, , 2014. Consistent with the identification of MED5b as a ref5 suppressor, a ref5-1 med5a med5b triple mutant generated by crossing ref5-1 with two T-DNA insertion mutants in MED5a and MED5b did not display a ref phenotype, although the characteristic ref5 high auxin morphology was maintained (Bonawitz et al, 2012; Figure 13A).…”

Section: Phenylpropanoid/glucosinolate Crosstalk Occurs Early In the mentioning

confidence: 99%

“…It has been shown previously that the Arabidopsis Mediator subunit MED5b/RFR1 and its paralog, MED5a/REF4, function semiredundantly in the repression of phenylpropanoid biosynthesis and med5a med5b double mutants contain increased levels of phenylpropanoids (Bonawitz et al, 2012(Bonawitz et al, , 2014. Consistent with the identification of MED5b as a ref5 suppressor, a ref5-1 med5a med5b triple mutant generated by crossing ref5-1 with two T-DNA insertion mutants in MED5a and MED5b did not display a ref phenotype, although the characteristic ref5 high auxin morphology was maintained (Bonawitz et al, 2012; Figure 13A). HPLC analyses showed increased phenylpropanoids in leaves and seedling roots (Figures Coniferin (A) and syringin (B) content in seedling roots as determined by HPLC.…”

Section: Phenylpropanoid/glucosinolate Crosstalk Occurs Early In the mentioning

confidence: 99%

“…Recent progress has revealed that in plants, Mediator functions in diverse biological processes include plant immunity (Kidd et al, 2009;Wathugala et al, 2012;Zhang et al, 2012;Zhang et al, 2013b;Lai et al, 2014), freezing tolerance (Knight et al, 2009;Hemsley et al, 2014), flowering (Imura et al, 2012;Zheng et al, 2013;Lai et al, 2014), hormone responses (Chen et al, 2012;Lai et al, 2014), and phenylpropanoid homeostasis (Bonawitz et al, 2012(Bonawitz et al, , 2014. A pair of recent studies with loss-of-function mutants showed that disruption of both MED5a and its paralog, MED5b, results in enhanced expression of phenylpropanoid biosynthetic genes and hyperaccumulation of various phenylpropanoids (Bonawitz et al, 2012(Bonawitz et al, , 2014. Three med5b alleles were identified from the ref5 suppressor screen, and ref5-1 med5a/b triple mutants accumulate elevated levels of phenylpropanoids as observed in the med5a/b double mutant ( Figure 13).…”

Section: Phenylpropanoid-glucosinolate Crosstalk Requires the Mediatomentioning

confidence: 99%

See 2 more Smart Citations

Indole Glucosinolate Biosynthesis Limits Phenylpropanoid Accumulation in Arabidopsis thaliana

et al. 2015

Self Cite

View full text Add to dashboard Cite

Plants produce an array of metabolites (including lignin monomers and soluble UV-protective metabolites) from phenylalanine through the phenylpropanoid biosynthetic pathway. A subset of plants, including many related to Arabidopsis thaliana, synthesizes glucosinolates, nitrogen-and sulfur-containing secondary metabolites that serve as components of a plant defense system that deters herbivores and pathogens. Here, we report that the Arabidopsis thaliana reduced epidermal fluorescence5 (ref5-1) mutant, identified in a screen for plants with defects in soluble phenylpropanoid accumulation, has a missense mutation in CYP83B1 and displays defects in glucosinolate biosynthesis and in phenylpropanoid accumulation. CYP79B2 and CYP79B3 are responsible for the production of the CYP83B1 substrate indole-3-acetaldoxime (IAOx), and we found that the phenylpropanoid content of cyp79b2 cyp79b3 and ref5-1 cyp79b2 cyp79b3 plants is increased compared with the wild type. These data suggest that levels of IAOx or a subsequent metabolite negatively influence phenylpropanoid accumulation in ref5 and more importantly that this crosstalk is relevant in the wild type. Additional biochemical and genetic evidence indicates that this inhibition impacts the early steps of the phenylpropanoid biosynthetic pathway and restoration of phenylpropanoid accumulation in a ref5-1 med5a/b triple mutant suggests that the function of the Mediator complex is required for the crosstalk.

show abstract

Section: Phenylpropanoid/glucosinolate Crosstalk Occurs Early In the mentioning

confidence: 99%

Section: Phenylpropanoid/glucosinolate Crosstalk Occurs Early In the mentioning

confidence: 99%

Section: Phenylpropanoid-glucosinolate Crosstalk Requires the Mediatomentioning

confidence: 99%

See 1 more Smart Citation

Indole Glucosinolate Biosynthesis Limits Phenylpropanoid Accumulation in Arabidopsis thaliana

et al. 2015

Self Cite

View full text Add to dashboard Cite

show abstract

“…For instance, MED16 (Mediator subunit 16), was reported as essential for salicylic acid (SA) and JA signaling pathways involved in cold tolerance, flowering control and circadian rhythm (Knight et al, 1999(Knight et al, , 2008(Knight et al, , 2009. MED14 was involved in leaf development and leaf cell proliferation (Autran et al, 2002) and MED33 was required for phenylpropanoid homeostasis (Bonawitz et al, 2012). MED25 was important for plant disease resistance, flowering and organ size (Cerdan and Chory, 2003;Kidd et al, 2009;Xu and Li, 2011), whereas MED17, MED18 and MED20 in the head module affected micro-RNA production .…”

Section: Introductionmentioning

confidence: 99%

The Arabidopsis Mediator subunit MED16 regulates iron homeostasis by associating with EIN3/EIL1 through subunit MED25

et al. 2014

View full text Add to dashboard Cite

These authors contributed equally to this work. SUMMARYIron is an essential micronutrient for plants and animals, and plants are a major source of iron for humans. Therefore, understanding the regulation of iron homeostasis in plants is critical. We identified a T-DNA insertion mutant, yellow and sensitive to iron-deficiency 1 (yid1), that was hypersensitive to iron deficiency, containing a reduced amount of iron. YID1 encodes the Arabidopsis Mediator complex subunit MED16. We demonstrated that YID1/MED16 interacted with another subunit, MED25. MED25 played an important role in regulation of iron homeostasis by interacting with EIN3 and EIL1, two transcription factors in ethylene signaling associated with regulation of iron homeostasis. We found that the transcriptome in yid1 and med25 mutants was significantly affected by iron deficiency. In particular, the transcription levels of FIT, IRT1 and FRO2 were reduced in the yid1 and med25 mutants under iron-deficient conditions. The finding that YID1/MED16 and MED25 positively regulate iron homeostasis in Arabidopsis increases our understanding of the complex transcriptional regulation of iron homeostasis in plants.

show abstract

“…MED18 was found to control flowering time and floral organ identity (Zheng et al, 2013). MED5a/MED33a/ REDUCED EPIDERMAL FLUORESCENCE4 (REF4)-RELATED1 and MED5b/MED33b/REF4 are required for phenylpropanoid homeostasis (Bonawitz et al, 2012). The Mediator kinase module subunits CYCLIN-DEPENDENT KINASE8 (CDK8)/HUA ENHANCER3, MED12/CRYPTIC PRECOCIOUS, and MED13/ MACCHI-BOU2 regulate the specification of floral organ identity, early embryo patterning/flowering, and embryo patterning/cotyledon organogenesis, respectively (Wang and Chen, 2004;Gillmor et al, 2010;Ito et al, 2011;Imura et al, 2012).…”

mentioning

confidence: 99%

The Arabidopsis Mediator Complex Subunit16 Is a Key Component of Basal Resistance against the Necrotrophic Fungal Pathogen Sclerotinia sclerotiorum

Wang

Yao

et al. 2015

Plant Physiol.

View full text Add to dashboard Cite

Although Sclerotinia sclerotiorum is a devastating necrotrophic fungal plant pathogen in agriculture, the virulence mechanisms utilized by S. sclerotiorum and the host defense mechanisms against this pathogen have not been fully understood. Here, we report that the Arabidopsis (Arabidopsis thaliana) Mediator complex subunit MED16 is a key component of basal resistance against S. sclerotiorum. Mutants of MED16 are markedly more susceptible to S. sclerotiorum than mutants of 13 other Mediator subunits, and med16 has a much stronger effect on S. sclerotiorum-induced transcriptome changes compared with med8, a mutation not altering susceptibility to S. sclerotiorum. Interestingly, med16 is also more susceptible to S. sclerotiorum than coronatine-insensitive1-1 (coi1-1), which is the most susceptible mutant reported so far. Although the jasmonic acid (JA)/ethylene (ET) defense pathway marker gene PLANT DEFENSIN1.2 (PDF1.2) cannot be induced in either med16 or coi1-1, basal transcript levels of PDF1.2 in med16 are significantly lower than in coi1-1. Furthermore, ET-induced suppression of JA-activated wound responses is compromised in med16, suggesting a role for MED16 in JA-ET cross talk. Additionally, MED16 is required for the recruitment of RNA polymerase II to PDF1.2 and OCTADECANOID-RESPONSIVE ARABIDOPSIS ETHYLENE/ETHYLENE-RESPONSIVE FACTOR59 (ORA59), two target genes of both JA/ETmediated and the transcription factor WRKY33-activated defense pathways. Finally, MED16 is physically associated with WRKY33 in yeast and in planta, and WRKY33-activated transcription of PDF1.2 and ORA59 as well as resistance to S. sclerotiorum depends on MED16. Taken together, these results indicate that MED16 regulates resistance to S. sclerotiorum by governing both JA/ET-mediated and WRKY33-activated defense signaling in Arabidopsis.

show abstract

REF4 and RFR1, Subunits of the Transcriptional Coregulatory Complex Mediator, Are Required for Phenylpropanoid Homeostasis in Arabidopsis

Cited by 110 publications

References 46 publications

Indole Glucosinolate Biosynthesis Limits Phenylpropanoid Accumulation in Arabidopsis thaliana

Indole Glucosinolate Biosynthesis Limits Phenylpropanoid Accumulation in Arabidopsis thaliana

The Arabidopsis Mediator subunit MED16 regulates iron homeostasis by associating with EIN3/EIL1 through subunit MED25

The Arabidopsis Mediator Complex Subunit16 Is a Key Component of Basal Resistance against the Necrotrophic Fungal Pathogen Sclerotinia sclerotiorum

Contact Info

Product

Resources

About