[Regular Paper] Suppression of Rancidification in Lightly Pickled Vegetables by Sugar Alcohols

Suppression of axillary odor and control of axillary bacterial flora by erythritol

“…Using this solution as template, DNA fragments were amplified using primer pairs covering hypervariable regions of the 16S rRNA gene: primers V3V4f_MIX and V3V4r_MIX (5'‐ACACTCTTTCCCTACACGACGCTCTTCCGATCT‐NNNNN‐CCTACGGGNGGCWGCAG‐3’ and 5'‐GTGACTGGAGTTCAGACGTGCTCTTCCGATCT‐NNNNN‐GACTACHVGGGTATCTAATCC, the underlined part is a homologous sequence with 16S rRNA genes). 10 The nucleotide sequence of this amplification product was analyzed by the next‐generation DNA sequencer MiSeq (Illumina) to obtain paired‐end reads. Chimeric sequences were then removed using QIIME 2™, and sequences with 97% homology or higher were summarized as one OTU (Operational taxonomy unit).…”

“…Furthermore, the growth of Lactobacillus plantarum , L . brevis , and Leuconostoc mesenteroides , which are lactic acid bacteria isolated from lightly pickled vegetables, was inhibited, and the microbial flora in lightly pickled vegetables was controlled by erythritol 10 …”

“…9 Furthermore, the growth of Lactobacillus plantarum, L. brevis, and Leuconostoc mesenteroides, which are lactic acid bacteria isolated from lightly pickled vegetables, was inhibited, and the microbial flora in lightly pickled vegetables was controlled by erythritol. 10 The present study investigated whether the application of erythritol to the axilla controls the indigenous skin flora and reduces axillary odor.…”

“…collected bacterial solution was placed in a crushing tube together with two 5φ zirconia beads, and crushed using the cell crusher Micro Smash TM MS-100 (Tomy Seiko, Japan) with a program of 4,000 rpm and 90 sec. Using this solution as template, DNA fragments were amplified using primer pairs covering hypervariable regions of the 16S rRNA gene: primers V3V4f_MIX and V3V4r_MIX (5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-N NNNN-CCTACGGGNGGCWGCAG-3' and 5'-GTGACTGGAGTTC AGACGTGCTCTTCCGATCT-NNNNN-GACTACHVGGGTATCTAAT CC, the underlined part is a homologous sequence with 16S rRNA genes) 10. The nucleotide sequence of this amplification product was analyzed by the next-generation DNA sequencer MiSeq (Illumina) to obtain paired-end reads.…”