Regulation of Inducible Heparanase Gene Transcription in Activated T Cells by Early Growth Response 1

Abstract

Cleavage of heparan sulfate by the ␤-D-endoglucuronidase heparanase (HPSE) is a fundamental event in a number of important physiological processes including inflammation, wound healing, and angiogenesis. HPSE activity has also been directly correlated with pathological conditions such as tumor growth and metastasis and autoimmune disease. The tight regulation of HPSE expression and function is critical to ensure homeostasis of the normal physiological processes to which it contributes and to prevent imbalance toward pathological situations. Little is known about the transcriptional mechanisms that regulate HPSE expression. In this study we have shown human HPSE gene transcription in Jurkat T cells is induced upon activation. Functional analysis of the HPSE promoter has identified a 280-bp region that is highly inducible. Mutation studies together with supershift experiments have identified a 4-bp motif that binds the transcription factor early growth response-1 (Egr1) and is critical in regulating inducible HPSE gene transcription. Furthermore, the overexpression of Egr1 resulted in the enhanced activation of the HPSE promoter. By using MAPK pathway inhibitors, we have also shown that inducible expression of HPSE mRNA and the activity of the 280-bp HPSE promoter element are dependent on the ERK1/2 (MEK1/2) pathway. This pathway is critical for induction of Egr1 expression at both the mRNA and protein level in T cells, an observation that provides further support to Egr1 playing an important role as a key activator of HPSE expression. In addition, HPSE and Egr1 were shown to co-localize by immunohistochemistry to invading mononuclear leukocytes in actively induced experimental autoimmune encephalomyelitis in rats. These findings provide the first insight into the mechanisms controlling inducible transcription of the HPSE gene, and could represent an important lead into understanding how HPSE expression is deregulated in metastatic tumor cells.Heparan sulfate proteoglycans are key structural components of the extracellular matrix (ECM) 1 and cell surfaces. They comprise a protein core covalently linked to linear chains of the complex sulfated glycosaminoglycan, heparan sulfate (HS) (1-3). The HS side chains of heparan sulfate proteoglycans mediate the assembly and stability of the ECM through interactions with the various matrix components (e.g. collagen, laminin, and fibronectin) (1, 3) and also specifically bind a range of cytokines and growth factors (e.g. basic fibroblast growth factor, hepatocyte growth factor, insulin-like growth factor, and transforming growth factor-␤) thereby functioning as a storage depot for these factors (4, 5). The ␤-D-endoglycosidase heparanase (HPSE) cleaves HS and facilitates the degradation of the ECM and the release of HS-bound growth factors (6, 7). Heparanase is a normal constituent of activated leukocytes, endothelial cells, vascular smooth muscle cells, and cytotrophoblasts; however, its expression is also "hijacked" by metastatic tumor cells (6, 7). The level of HPSE activit...

Promoter CpG hypomethylation and transcription factor EGR1 hyperactivate heparanase expression in bladder cancer

“…Based on the functional promoter sequence of heparanase gene (De Mestre et al, 2003), MSP and USP primers were specifically designed to analyse the difference in promoter CpG methylation between normal bladder and bladder cancer. Several important consensus transcription factor binding sites are present within the heparanase gene promoter, that is, Sp1 contributes to basal transcription of heparanase (Jiang et al, 2002), and the EGR1 site is essential for its inducible transcription (De Mestre et al, 2003). EGR1 is a zinc-finger transcription factor found in smooth muscle cells (Silverman et al, 1997) and endothelial cells (Khachigian et al, 1996).…”

“…Recently, promoter methylation has been associated with the regulation of heparanase expression in cancer cell lines (Shteper et al, 2003). In addition to the active involvement of promoter methylation in heparanase regulation, early growth response 1 (EGR1), a member of the zinc-finger family of transcription factors, has been shown to be important in the inducible transcription of the heparanase gene (De Mestre et al, 2003). The core binding motif of EGR1 (CCGC) has one CpG site within its sequence and is located within the proximal heparanase promoter region (De Mestre et al, 2003).…”

“…In addition to the active involvement of promoter methylation in heparanase regulation, early growth response 1 (EGR1), a member of the zinc-finger family of transcription factors, has been shown to be important in the inducible transcription of the heparanase gene (De Mestre et al, 2003). The core binding motif of EGR1 (CCGC) has one CpG site within its sequence and is located within the proximal heparanase promoter region (De Mestre et al, 2003). Taking these facts into consideration, we hypothesize that CpG hypomethylation of the heparanase promoter coupled with EGR1 levels are related to increased heparanase expression in human bladder cancer.…”

NK cell heparanase controls tumor invasion and immune surveillance

“…HPSE was cloned into the pCDNA3 vector and UBC into the pCR3.1 vector. The housekeeping gene UBC was used as the baseline control for internal gene expression (62). For mouse Hpse, cDNA was amplified using FastStart SYBR Green Master (Roche) using the Agilent Mx3000P qPCR System (Agilent Technologies) and the following primers: Hpse, forward: CGTCTATCACCCACGATATC; Hpse, reverse: CAGTTGGA-CAGATTTAGGAAG; Gapdh, forward: TTCCGTGTTCCTACCCCCA; and Gapdh, reverse: GCTTCACCACCTTCTTGATGTC.…”

Two promoters with distinct activities in different tissues drive the expression of heparanase in Xenopus

“…The 2.1-kb fragment containing the Xenopus Hpa promoter was aligned with the corresponding region of the human and mouse Hpa promoters to determine similarities between the DNA and to identify promoter elements conserved between the three species. Interestingly, while human and mouse sequences show a high degree of identity (more than 80%) in the first 600 bp upstream of the translation start site (Jiang et al, 2002;de Mestre et al, 2003;de Mestre et al, 2007), Xenopus DNA is highly divergent (38% identity with both human and mouse). Moreover, Sp1 and Ets-relevant elements (ERE) sites, critical for human heparanase promoter activity (Jiang et al, 2002) are not present in Xenopus.…”