Regulation of ornithine decarboxylase in B16 mouse melanoma cells: synergistic activation of melanogenesis by αMSH and ornithine decarboxylase inhibition

Abstract

Ornithine decarboxylase (ODC) is the rate-limiting enzyme in the biosynthesis of polyamines, a family of cationic compounds required for optimal cell proliferation and differentiation. Within mammalian melanocytes, the expression of genes regulating cell growth and/or differentiation can be controlled by alpha-melanocyte-stimulating hormone (alphaMSH) and other melanogenesis modulating agents. In the B16 mouse melanoma model, alphaMSH stimulates melanogenesis by upmodulation of tyrosinase (tyr) activity, whereas the phorbol ester 12-O-tetradecanoylphorbol 13-acetate (TPA) inhibits melanin synthesis. Therefore, we analyzed the regulation of ODC by these agents, as related to changes in the melanogenic pathway. Treatment of B16 cells with TPA or alphaMSH rapidly stimulated ODC activity. The effect was stronger for TPA and appeared mainly posttranslational. Irreversible inhibition of ODC with the active site-directed inhibitor alpha-difluoromethylornithine (DFMO) did not block TPA-mediated inhibition of tyr. Conversely, prolonged treatment of B16 cells with DFMO stimulated tyr activity by a posttranslational mechanism, probably requiring polyamine depletion. Combination treatment with alphaMSH and DFMO synergistically activated tyr. Therefore, ODC induction is not involved in the melanogenic response of B16 cells to alphaMSH. Rather, increased intracellular concentrations of polyamines following ODC induction might constitute a feedback mechanism to limit melanogenesis activation by alphaMSH.

Mahogunin Ring Finger 1 regulates pigmentation by controlling the pH of melanosomes in melanocytes and melanoma cells

“…The polyamines putrescine, spermidine and spermine are ubiquitous basic compounds with the potential to raise the pH of subcellular compartments. Moreover, polyamines have been shown to modulate melanogenesis although their effects on pigment production remain uncertain since both activation by putrescine [ 61 ] and by the putrescine synthesis inhibitor difluoromethylornithine (DFMO) [ 62 ] have been reported. We confirmed by qPCR the differential expression of genes encoding key enzymes and regulatory proteins of the polyamines biosynthetic pathway (Supplementary Fig.…”

“…Moreover, inhibition of polyamine biosynthesis with DFMO lowered polyamine contents in melan-a6 cells and blocked cell proliferation but stimulated two–threefold both TYR activity in situ and melanin content (Supplementary Fig. S4e), in agreement with our previous data [ 62 ], thus ruling out a major role of polyamine metabolism in increasing intramelanosomal pH.…”

Sexual dimorphism of ornithine decarboxylase in the mouse adrenal: influence of polyamine deprivation on catecholamine and corticoid levels

“…Total RNA from several pools of three to four adrenals from different mice was isolated with guanidinium thiocyanate, denatured with glyoxal and DMSO, electrophoresed on 1.5% agarose gels in 10 mM sodium phosphate buffer, pH 7.0, and transferred to Hybond nylon membrane. Prehybridization and hybridization were performed as described (44). The random priming 32 P-labeled probe used was 550-bp ODC fragment (primers GGATT-TGACTGTGCAAGC and GAGTCTGATGGGA AGTAC) and 282-bp GAPDH fragment (primers CGTCTTCACCACCATGGAGA and CGGCCATCACGCCACAGTTT).…”

P-Hydroxycinnamaldehyde Induces B16-F1 Melanoma Cell Differentiation via the RhoA-MAPK Signaling Pathway

“…Melanin release was measured as previously described [12]. Briefly, cells were incubated with different doses of CMSP or Forskolin (10 µM) for 72 h and were then washed with PBS and dissolved in 1.0 N NaOH for 1 h at 80°C.…”