Release of the p53-Induced Repression on Thymidine Kinase Promoter by Single p53-Binding Sequence

Yuan, Jean Nian; Liu, Biing-Hui; Heng, Lee Yook; Shaw, Yueh Tsern; Chiou, Shean Tai; Chang, Wen Chang; Lai, Ming Derg

doi:10.1006/bbrc.1993.1268

Cited by 9 publications

(7 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…While further studies to delineate the underlying mechanisms are necessary, the findings raise the interesting notion that p53 has the ability to shut down the expression of critical viral regulatory proteins and thereby prevent a lytic replication cycle to perhaps favor the establishment of latency. Our results are consistent with a previous report by Yuan et al (20) in which the p53RE in the HSV-1 thymidine kinase gene promoter binds p53 and is involved in the repression of thymidine kinase gene expression.…”

Section: Discussionsupporting

confidence: 94%

“…p53 is known to have differential effects on several viral systems. Not considering our current findings, only three other conserved p53RE have been characterized in viral systems including: in the enhancer of hepatitis B virus (5’ TTG CATG TATacaagctAAA CAGG CTT) (29), in the non-coding region of human papillomavirus 77 (5’ AAA CATG TTTGCA AATC CCC) (33), and in the HSV-1 thymidine kinase gene promoter (5’ TGCCTTGCCTGGACTTGCCTGGCCTTGCCTTT) (20). Additionally, it has been reported that p53 can bind to atypical viral DNA elements such as the GC boxes of the simian virus 40 early promoter (34) and the long terminal repeat of human immunodeficiency virus-1 (35).…”

Section: Discussionmentioning

confidence: 83%

“…1B shows a comparison and sequence alignment between p53RE-L and p53RE-S and other well characterized p53RE, including those associated with the HSV-1 TK (20), BCL6 (19), ABCA1 (21), GADD45A (22), p21 (23), MDM2 (24), VDR (25), p73 (26), CASP6 (27), and CASP10 (28) genes, and hepatitis B virus (29). It should also be noted that albeit not the subject of the current studies, our analysis indicates that candidate p53RE exist in other herpesvirus family members including Varicella Zoster Virus, Epstein Barr virus and cytomegalovirus (data not shown).…”

Section: Resultsmentioning

confidence: 99%

See 2 more Smart Citations

Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome

et al. 2014

View full text Add to dashboard Cite

Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency.

show abstract

Section: Discussionsupporting

confidence: 94%

Section: Discussionmentioning

confidence: 83%

Section: Resultsmentioning

confidence: 99%

See 1 more Smart Citation

Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome

et al. 2014

View full text Add to dashboard Cite

show abstract

“…Recent evidence suggested that p53 may play a role in the response of cells to DNA damage induced by agents such as y rays and drugs [ I 3-1 81. Biochemically, p53 can bind to certain DNA sequences specifically [ I 9-2 I ] and can regulate the expression of genes containing a p53-binding site [20,22,23]. Therefore, p53 is thought to specifically bind to and transactivate certain genes that control the G11S transition [lo-121.…”

Section: Introductionmentioning

confidence: 99%

Overexpression of MDM‐2 mRNA and mutation of the p53 tumor suppressor gene in bladder carcinoma cell lines

Cheng

et al. 1995

Molecular Carcinogenesis

View full text Add to dashboard Cite

To investigate the importance of oncogenes and tumor suppressor genes in bladder carcinogenesis, we determined the status of the expression of the MDM-2 and p53 genes and genetic alterations in the p53 gene in five bladder carcinoma cell lines and one kidney urothelial carcinoma cell line. Overexpression of MDM-2 mRNA was observed in three bladder carcinoma cell lines, J82, SCaBER, and BFTC-905. Amplification of the MDM-2 gene was not detected in any of the six cell lines by southern analysis. The deletion in the p53 gene was observed in J82, and point mutation was detected in J82 and BFTC-909, the kidney urothelial carcinoma cell line. In contrast, no mutations were found in codons 12, 13, and 61 in the Ha-ras and Ki-ras genes in these six cell lines. These results indicate that alterations in the p53-regulated pathway are important in bladder carcinogenesis.

show abstract

“…The TK promoter can be induced by the Human T-lymphotrophic Virus type 1 (HTLV-1) Tax protein [10], the androgen analog R1881 [11], and the transcription factors GATA4 and GATA6 [12]. The TK promoter can be suppressed by wild type p53 [13], dexamethasone [14], and nuclear receptors such as Chicken Ovalbumin Upstream Promoter Transcription Factor-1 (COUP-TFI) and Peroxisome Proliferator Activator Receptor alpha (PPARα) [15]. …”

Section: Introductionmentioning

confidence: 99%

PMA induces expression from the herpes simplex virus thymidine kinase promoter via the activation of JNK and ERK in the presence of adenoviral E1A proteins

Shifera

Hardin

2009

Archives of Biochemistry and Biophysics

View full text Add to dashboard Cite

The herpes simplex virus type 1 (HSV-1) thymidine kinase (TK) promoter contains elements involved in both constitutive and induced expression. We determined that phorbol 12-myristate 13-acetate (PMA) induces the HSV-1 TK promoter in HEK293 cells. However, PMA did not induce expression from the promoter in HeLa cells and did not result in a globally increased gene expression in HEK293 cells. Induction of HSV-1 TK promoter required activation of both of JNK and ERK pathways. However, activation of the two pathways alone was not sufficient for induction of HSV-1 TK promoter. By transiently transfecting into HeLa cells the adenoviral E1A gene, which exists as an integrant in HEK293 genome, we demonstrated that E1A proteins are necessary for induction of HSV-1 TK promoter by PMA. We propose mechanisms by which signaling pathways activated by the tumor-promoter PMA cooperate with the oncogene E1A to stimulate a eukaryotic promoter, namely the HSV-1 TK promoter.

show abstract

Release of the p53-Induced Repression on Thymidine Kinase Promoter by Single p53-Binding Sequence

Cited by 9 publications

References 0 publications

Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome

Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome

Overexpression of MDM‐2 mRNA and mutation of the p53 tumor suppressor gene in bladder carcinoma cell lines

PMA induces expression from the herpes simplex virus thymidine kinase promoter via the activation of JNK and ERK in the presence of adenoviral E1A proteins

Contact Info

Product

Resources

About