Rendezvin: An Essential Gene Encoding Independent, Differentially Secreted Egg Proteins That Organize the Fertilization Envelope Proteome after Self-Association

Wong, Julian L.; Wessel, Gary M.

doi:10.1091/mbc.e06-07-0634

Cited by 15 publications

(25 citation statements)

References 55 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Egg activation triggers cortical granule exocytosis (CGE) and cytoplasmic streaming to form the blastodisc at the animal pole. Cortical granules (CG) release their contents at the egg cortex, contributing to chorion expansion and surface remodeling (Fuentes and Fernandez, 2010;Hart, 1990;Tsaadon et al, 2006;Wong and Wessel, 2006). Stabilizing or destabilizing F-actin established the dependence of both CGE and cytoplasmic streaming on a dynamic actin cytoskeleton (Becker and Hart, 1999;Fernandez et al, 2006;Hart and Fluck, 1996;Ivanenkov et al, 1987;Leung et al, 2000;Wolenski and Hart, 1988).…”

Section: Introductionmentioning

confidence: 99%

Dachsous1b cadherin regulates actin and microtubule cytoskeleton during early zebrafish embryogenesis

et al. 2015

View full text Add to dashboard Cite

Dachsous (Dchs), an atypical cadherin, is an evolutionarily conserved regulator of planar cell polarity, tissue size, and cell adhesion. In humans, DCHS1 mutations cause pleiotropic Van Maldergem syndrome. Here, we report that mutations in zebrafish dchs1b and dchs2 disrupt several aspects of embryogenesis, including gastrulation. Unexpectedly, maternal zygotic (MZ) dchs1b mutants show defects in the earliest developmental stage, egg activation, including abnormal cortical granule exocytosis (CGE), cytoplasmic segregation, cleavages, and maternal mRNA translocation, in transcriptionally quiescent embryos. Later, MZdchs1b mutants exhibit altered dorsal organizer and mesendodermal gene expression, due to impaired dorsal determinant transport and Nodal signaling. Mechanistically, MZdchs1b phenotypes can be explained in part by defective actin or microtubule networks, which appear bundled in mutants. Accordingly, disruption of actin cytoskeleton in wild-type embryos phenocopied MZdchs1b mutant defects in cytoplasmic segregation and CGE. Whereas, interfering with microtubules in wild-type embryos impaired dorsal organizer and mesodermal gene expression without perceptible earlier phenotypes. Moreover, the bundled microtubule phenotype was partially rescued by expressing either full-length Dchs1b or its intracellular domain, suggesting Dchs1b affects microtubules and some developmental processes independent of its known ligand Fat. Our results indicate novel roles for vertebrate Dchs in actin and microtubule cytoskeleton regulation in the unanticipated context of the single-celled embryo.

show abstract

Section: Introductionmentioning

confidence: 99%

Dachsous1b cadherin regulates actin and microtubule cytoskeleton during early zebrafish embryogenesis

et al. 2015

View full text Add to dashboard Cite

show abstract

“…Blots destined for DSB-biotin detection were blocked in 1% BSA in TBST [170 mM NaCl, 50 mM Tris, 0.05% Tween20 (v/v), pH 8.0], then probed overnight with Extravidin-AP (1:300,000 dilution; Sigma-Aldrich). Immunoblots were blocked in Blotto [3% non-fat dry milk (w/v), 170 mM NaCl, 50 mM Tris, 0.05% Tween20 (v/v)], and then probed overnight with rabbit antisera against proteoliaisin Somers and Shapiro, 1991), SFE1 (Wessel et al, 2000a), SFE9 (Wessel, 1995), separate epitopes of rendezvin (Wong and Wessel, 2006b), ovoperoxidase (LaFleur, Jr et al, 1998), or fertilization envelope-incorporated vitelline layer (J.L.W. and G.M.W., unpublished).…”

Section: Identification Of Ovoperoxidase Protein Targets Within the Fmentioning

confidence: 99%

“…4B). Probing tyramine-SFEs with antibodies against the amino-(represented by RDZ anti-␣␥␦) or carboxy-domains (RDZ anti-) of rendezvin (Wong and Wessel, 2006b) shows that only the carboxyl terminus of rendezvin (RDZ 120 ) co-migrates with this fluorescent band. To determine if this is true in situ, we used an unbiased crosslinking assay probing whole cell homogenates of zygotes fertilized in the presence of either the direct ovoperoxidase inhibitor 3-AT or the dual oxidase inhibitor diphenyleneiodonium (DPI), which indirectly inhibits ovoperoxidase crosslinking by blocking substrate availability (Showman and Foerder, 1979;.…”

Section: Research Articlementioning

confidence: 99%

Free-radical crosslinking of specific proteins alters the function of the egg extracellular matrix at fertilization

Wong

Wessel

2008

Development

Self Cite

View full text Add to dashboard Cite

All animal embryos begin development by modifying the egg extracellular matrix. This protein-rich matrix protects against polyspermy, microbes and mechanical stress via enzyme-dependent transformations that alter the organization of its constituents. Using the sea urchin fertilization envelope, a well-defined extracellular structure formed within minutes of fertilization, we examine the mechanisms whereby limited permeability is established within this matrix. We find that the fertilization envelope acquires a barrier filtration of 40,000 daltons within minutes of insemination via a peroxidase-dependent mechanism, with dynamics that parallel requisite production of hydrogen peroxide by the zygote. To identify the molecular targets of this freeradical modification, we developed an in vivo technique to label and isolate the modified matrix components for mass spectrometry. This method revealed that four of the six major extracellular matrix components are selectively crosslinked, discriminating even sibling proteins from the same gene. Thus, specific free-radical chemistry is essential for establishing the embryonic microenvironment of early development.

show abstract

“…These samples were prepared and imaged as previously described (Wong and Wessel, 2006b). Each colloidal gold particle was scored according to its location along the egg cortex or the fertilization envelope, and normalized over the length of each structure analyzed.…”

Section: Polyclonal Antibody Analysismentioning

confidence: 99%

“…The major structural proteins of the S. purpuratus fertilization envelope proteome (Wong and Wessel, 2006b) are crosslinked by these enzymes at either microvillar casts or intercast domains (Wong and Wessel, 2008), establishing a mechanically 'hardened' shell for early embryogenesis. The relatively uniform contribution of these two enzyme activities is conserved among sea urchins (Cariello et al, 1994;Veron et al, 1977), even though other animals do not require two enzymes to achieve an analogously 'hardened' matrix: Transamidation is sufficient to harden the matrices of mosquito (Iijima et al, 2005) and most teleost eggs (Chang et al, 2002;Ha and Iuchi, 1998;Oppen-Berntsen et al, 1990;Yamagami et al, 1992); peroxidase is required for the teleost Tribulon (Kudo, 1988); and a zinc-dependent protease accomplishes the same task for amphibians (Lindsay and Hedrick, 2004).…”

Section: Research Articlementioning

confidence: 99%

Extracellular matrix modifications at fertilization: regulation of dityrosine crosslinking by transamidation

Wong

Wessel

2009

Development

Self Cite

View full text Add to dashboard Cite

Fertilization is accompanied by the construction of an extracellular matrix that protects the new zygote. In sea urchins, this structure is built from glycoproteins residing at the egg surface and in secretory vesicles at the egg cortex. Four enzymatic activities are required for the transformation of these proteins into the mechanically and chemically resilient fertilization envelope: proteolysis, transamidation, NADPH-dependent oxidation and peroxidation. Here, we identify the Strongylocentrotus purpuratus enzymes responsible for the formation of ε(γ-glutamyl)lysine crosslinks (transamidation). We find that these two transglutaminases are activated by local acidification and act on specific substrates within the fertilization envelope (including ovoperoxidase, rendezvin and SFE9). Surprisingly, these enzymes also regulate dityrosine crosslinking both by direct conjugation of ovoperoxidase and by modulating hydrogen peroxide production. Together, these results emphasize how transglutaminases can coordinate the activities of other enzymes during extracellular matrix transmogrifications. Development 136, 1835Development 136, -1847Development 136, (2009Development 136, ) doi:10.1242 Department of Molecular Biology, Cell Biology, and Biochemistry, Box G-L173, 185 Meeting Street, Brown University, Providence, RI 02912, USA. KEY WORDS: Extracellular matrix, Fertilization, Transamidation, Transglutaminase, Sea urchin*Author for correspondence (e-mail: rhet@brown.edu) Accepted 9 March 2009 DEVELOPMENT MATERIALS AND METHODS AnimalsStrongylocentrotus purpuratus gametes were obtained and handled as previously described . RNA in situ hybridizationAntisense digoxigenin-labeled RNA probes (DIG RNA Labeling Kit (SP6/T7); Roche Diagnostics Corporation, Indianapolis, IN, USA) representing S. purpuratus eTG (nucleotides 1274 to 1802) and nTG (nucleotides -62 to 403) or negative control probe (neomycin phosphotransferase II) were used at 0.1 μg probe/ml to detect native transcript in oocytes according to previously published protocols (ArenasMena et al., 2000). Quantitative PCRReal-time quantitative PCR was conducted on about 0.1 μg-equivalents of total RNA isolated from hand-collected oocytes or eggs (Song et al., 2006). Primers representing the 3Ј-end of each transglutaminase open reading frame were used to amplify products for eTG (199 bp using F=5Ј CACT-GAGGATTTGATGGTTGG with R=5Ј GGTTGCCTGTCTTCTTTGGT) and nTG (169 bp using F=5Ј CCACCGGAGATGAAGACTGA with R=5Ј TTGCCCTTTGAAGGAACATC), and cycle numbers were normalized to ubiquitin (~147 bp using F=5Ј CACAGGCAAGACCATCACAC; R=5Ј GAGAGAGTGCGACCATCCTC). Each PCR reaction was run off of cDNA (TaqMan Reverse Transcription kit; Applied Biosystems, Foster City, CA, USA) using Platinum SBYR Green qPCR SuperMix-UDG with ROX (Invitrogen Corporation, Carlsbad, CA, USA) on a 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Production of polyclonal antiseraAntiserum was raised in rabbits against bacterially overexpressed, recombinant fragments subcloned downstream of ...

show abstract

Rendezvin: An Essential Gene Encoding Independent, Differentially Secreted Egg Proteins That Organize the Fertilization Envelope Proteome after Self-Association

Cited by 15 publications

References 55 publications

Dachsous1b cadherin regulates actin and microtubule cytoskeleton during early zebrafish embryogenesis

Dachsous1b cadherin regulates actin and microtubule cytoskeleton during early zebrafish embryogenesis

Free-radical crosslinking of specific proteins alters the function of the egg extracellular matrix at fertilization

Extracellular matrix modifications at fertilization: regulation of dityrosine crosslinking by transamidation

Contact Info

Product

Resources

About